Answer:
Root hairs
Explanation:
This is because the root hairs are part of root structure that are tubular and have lateral enlongations.
The root hairs increase the surface area of the root and allow for exchange.
They gave direct contact with the soil and then absorb water and nutrients to their increased surface area.
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
Write a 200-word report on your research, using proper grammar, correct spelling, and appropriate punctuation. Make sure you include:
A definition of overgrazing
A discussion on the damage overgrazing can cause
The advantages and disadvantages of each type of grazing
A discussion on the type of grazing you select to use, which includes your justification of why you selected the grazing strategy
Answer:
answer is in explanation before
Explanation:
Overgrazing occurs when plants are exposed to intensive grazing for extended periods of time, or without sufficient recovery periods. It can be caused by either livestock in poorly managed agricultural applications, game reserves, or nature reserves. Overgrazing combined with overstocking has the most damaging outcomes to the world’s natural environment. The scarcity of water resources, water pollution, degeneration of coral reefs, and eutrophication are all connected to overgrazing. The chief polluting elements include farm chemicals and animal wastes.
Types of grazing systems 1. Types of grazing systems Grazing animals (such as cattle, sheep and goats) feed on the leaves and shoots of grass... 2. Zerograzing In this type of grazing system, the animals are not allowed to go out into the pastureto graze.
Overgrazing is defined as the practice of allowing too many livestock to graze on a particular area of land for an extended period. This leads to a decrease in the vegetation cover and the soil's capacity to hold moisture, which results in soil erosion and desertification.
What is overgrazing?There are three types of grazing systems: continuous grazing, rotational grazing, and intensive grazing. Continuous grazing involves leaving livestock on a particular area of land throughout the year. Rotational grazing involves rotating livestock to different areas of land to prevent overgrazing. Intensive grazing involves keeping livestock in smaller paddocks and rotating them frequently.
Hence, overgrazing is defined as the practice of allowing too many livestock to graze on a particular area of land for an extended period. This leads to a decrease in the vegetation cover and the soil's capacity to hold moisture, which results in soil erosion and desertification.
Learn more about overgrazing here.
https://brainly.com/question/28916992
#SPJ2
Which process begins the formation of sedimentary rock?
When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body
Answer:
Brain stem
Explanation:
I hope this helps
People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?
If a population is evolving, the allele frequency ________
What is the Florida state lizard (don’t search) just guess
What is the main difference between active transport and passive transport?
(A) During active transport the water inside the cell is used to transport substances throughout the cell. Passive transport uses the cell's cytoplasm to move substances around the cell.
(B) Passive transport moves substances throughout the cell without using the cell's energy and active transport moves substances using the cell's energy.
(C) Active transport moves substances from higher concentrations to lower concentrations and passive transport moves substances from lower concentrations to higher concentrations.
(D) Passive transport moves substances that are too large to get through the cell membrane by forming a vesicle inside the cell and active transport forms the vesicle on the outside of the cell.
Answer:
B
Explanation:
passive transport uses diffusion to transport while active transport uses some energy most commonly atp
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea
Answer:
Yes.
Explanation:
Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
In the mouse model of malaria, the researchers injected Plasmodium-infected human red blood cells into the mice because the Plasmodium species had surface ligand proteins that bound only to cell membrane proteins of human red blood cells. Assume that the researchers noticed that some of the parasites no longer infected human red blood cells but instead infected mouse red blood cells. Predict the most likely cause of this change in the host specificity of the parasites. Plasmodium reproduces both sexually in the host vertebrate and asexually in mosquitoes. The researchers claim that the Plasmodium organisms that infect the two different types of red blood cells are likely to evolve into two separate species of Plasmodium. Based on the biological species concept, provide reasoning that would support the researchers’ claim.
dead cells are removed from the Dermis by phagocytosis. true or false?
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
Please help!!
Explain why it would be financially beneficial for a farmer to treat a fruit crop with gibberellins.
Answer:
Gibberellins can promote flowering, which can result in more financially profitable flowers to sell due to the increased speed of flower growth. More attractive flowers and larger specimens are also produced. Flowering also has an impact on the rate of fruit growth.
Explanation:
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.
The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.
The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.
A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
What is a hypothesis?An scientific hypothesis is a given explanation to a scientific observation from the real world.
A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.
In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
Learn more about hypotheses here:
https://brainly.com/question/11555274
#SPJ1
4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks
Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.
Bill Nye Earth's crust
Answer:
1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust
Explanation:
Which type of muscle is long and striated and contains multiple nuclei?
Smooth Muscle
Cardiac Muscle
Muscle of the Digestive System
Skeletal Muscle
Answer:
Skeletal Muscle
Explanation:
Answer:
Skeletal Muscle
Explanation:
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.