Which of these ordered pairs are points on the graph of y= -5x+2?

a) (4, -22)
b) (-2,-8)
c) (-1, 7)
d) (1,3)

Answers

Answer 1

Answer:

Once again idk

Step-by-step explanation:

honestly it don't matter cuz the test is done :)


Related Questions

Find the area of the shape shown below

Answers

The area of a trapezoid is A = (a+b/2)(h).
So just plug in your numbers.

Which of the following statements is true for inverse functions ƒ(x) and g(x)?

Question 1 options:

A) 
(ƒ ∘ g)(x) = (g ∘ ƒ)(x) = x

B) 
(ƒ ∘ g)(x) = (g ∘ ƒ)(x) = 0

C) 
(ƒ ∘ g)(x) = (g ∘ ƒ)(x) = 1

D) 
(ƒ ∘ g)(x) = (g ∘ ƒ)(x) = ƒ(x)​

Answers

Answer:

A

Step-by-step explanation:

Given: functions f(x) and g(x)

To choose: the correct option

Solution:

A function is a relation in which each element of the domain has a unique image in the co-domain.

Composition of functions refers to the combining of two or more functions such that the output of one function becomes the input for the next function.

Two functions f(x) and g(x) are inverse functions if (ƒ ∘ g)(x) = (g ∘ ƒ)(x) = x.

Answer:

A) (ƒ ∘ g)(x) = (g ∘ ƒ)(x) = x

Step-by-step explanation:

Today, Isaac needs to walk his dog, water the garden, and feed his fish. DDD is the number of minutes it takes to walk his dog, GGG is the number of minutes it takes to water the garden, and FFF is the number of minutes it takes to feed his fish. The expression G+(D+F)G+(D+F)G, plus, (, D, plus, F, )describes the total number of minutes it takes Isaac to do all three tasks. We can also use the expression (G+D)+F(G+D)+F(, G, plus, D, ), plus, F to represent the same quantity. Match each amount in the situation with the expression that represents it. For reference: The dog is an animal, and he needs to go outside to walk. The garden is a bunch of plants (not an animal), and it is outside. The fish is an animal, and she lives in a water tank inside.

Answers

Answer:

The total Minutes of the tasks involving animals.-D+F (Dog and fish)The total Minutes of the tasks not involving animals.-G (Garden)The total Minutes of the Inside tasks.-F (Fish)The total Minutes of the Outside tasks.-G+D (Garden and Dog)

Step-by-step explanation:

We are told that:

D = number of minutes it takes to walk his dog

G = number of minutes it takes to water the garden; and

F = number of minutes it takes to feed his fish

We are required to match the given situations to its respective expressions:

Situation

The total Minutes of the Inside tasks.

The total Minutes of the Outside tasks.

The total Minutes of the tasks involving animals.

The total Minutes of the tasks not involving animals.

Expression

D+F

G+D

G

F

Note

G and D are outside tasks while F is an inside task.D and F involves animals while G does not.

Therefore, the match of the situation and respective expressions are:

The total Minutes of the tasks involving animals.-D+F (Dog and fish)The total Minutes of the tasks not involving animals.-G (Garden)The total Minutes of the Inside tasks.-F (Fish)The total Minutes of the Outside tasks.-G+D (Garden and Dog)

En un informe se dice que la temperatura minima pronosticada es de -24°C y la maxima de -20°C . Si la temperatura minima representa mas frio que la temperatura maxima,¿no deberia figurar al reves?. Expliquen su respuesta.

Answers

Answer:

Check Explanation

Step-by-step explanation:

English Translation

In a report it is said that the predicted minimum temperature is -24 ° C and the maximum is -20 ° C. If the minimum temperature represents colder than the maximum temperature, should it not appear on the reverse? Explain your answer.

Solution

No, it shouldn't appear on the reverse. This is because, just as negative numbers work, they decrease, the further we move away from 0.

Celsius temperature scales are calibrated with respect to the freezing point of water. The freezing point of water serves as the reference point and is called the 0°C.

Temperatures higher than the freezing point of water taken on positive values and temperatures lower, take on negative values. The lower the temperature, the bigger the absolute value of the negative value is.

For example, just like In the question provided, -24°C represents a temperature that is 24° lower than the freezing point of water while -20°C represents a temperature that is 20° lower than the freezing point of water. It is evident that -24°C really is a lower temperature than -20°C.

Hope this Helps!!!

Find the volume of the basketball with a radius of 6 inches. Which is closest to
the amount of air needed to fill the ball? Use 3.14 for
TT
Use the formula
4
V =
der
3
O 452 in 3
150 in 3
O 113 in 3
904 in 3​

Answers

Answer:

904.78 in^3

Step-by-step explanation:

We know basketball is a sphere,So

Volume of a spherical basketball = 4/3πr^3

Given radius = 6 inches

= 4/3πr^3

= 4/3×3.14×6^3

= 904.78 inches^3

hope it helps!

Answer:

453 in 3

Step-by-step explanation:

I need help in fractions​

Answers

Answer:

I’ll help you just show me the question

Step-by-step explanation:

Help!!! multiple choice!

Answers

5.C

6.A

Hope this helps and is correct

Value of x explain how you found the value of x

Answers

Answer:

A) 25

Step-by-step explanation:

Set the ratios. Place the similar sides equal to each other.

Sides:

AB/CB = XY/ZY

Plug in corresponding numbers to the corresponding sides:

50/40 = x/20

Simplify. Divide 2 from both the numerator and denominator of the first fraction to get common denominators:

(50/40)/(2/2) = 25/20

25/20 = x/20

x = 25

A) 25 is your answer.

~

Answer: A 25

Step-by-step explanation:



The perimeter of a​ standard-sized rectangular rug is 36 ft. The length is 2 ft longer than the width. Find the dimensions.

Answers

The length is 10 and the width is 8

Answer and Step-by-step explanation:

The length is 10 and the width is 8

-3(x + 4) = 6(-x - 1)

Answers

Answer: x = 2

Step-by-step explanation:

Answer:

x=2

Step-by-step explanation:

-3(x+4)=6(-x-1)

1. Distribute

-3x+(-12)=-6x-6

-3x-12=-6x-6

3x-12=-6

3x=6

x=2

help please! ill mark brainliest

Answers

Answer:

A=150ft^2

Step-by-step explanation:

A=(b1+b2)/2*h

A=(15+10)/2*12

A=25/2*12

A=25*6

A=150ft^2

Area of trapezoid formula: A = h(b1+b2/2)

A = 12(10+15/2)

A = 12(25/2)

A = 12(12.5)

A = 150

Therefore, the area of the trapezoid is 150ft²

Best of Luck!

I need to know every thing for online classes

Answers

Answer:

An online class is a course conducted over the Internet. They are generally conducted through a learning management system, where students can view their course syllabus and academic progress, as well as communicate with classmates and their course instructor.

Step-by-step explanation:

Write an equation for an ellipse centered at the origin, which has foci at ( 0 , ± 24 ) (0,±24)left parenthesis, 0, comma, plus minus, 24, right parenthesis and co-vertices at ( ± 10 , 0 ) (±10,0)

Answers

Answer:

[tex]\frac{x^{2}}{400} + \frac{y^{2}}{976} = 1[/tex]

Step-by-step explanation:

The distance between foci with respect to origin is determined by mean of the Pythagorean Theorem:

[tex]2\cdot c = \sqrt{(0-0)^{2}+[24-(-24)]^{2}}[/tex]

[tex]2\cdot c = 48[/tex]

[tex]c = 24[/tex]

The distance between origin and any of the horizontal co-vertices is:

[tex]a = \sqrt{[10-(-10)]^{2}+(0-0)^{2}}[/tex]

[tex]a = 20[/tex]

Now, the distance between origin and any of the vertical co-vertices is determined by the following Pythagorean relationship:

[tex]c^{2} = b^{2} - a^{2}[/tex]

[tex]b^{2} = a^{2} + c^{2}[/tex]

[tex]b = \sqrt{a^{2}+c^{2}}[/tex]

[tex]b = \sqrt{20^{2}+ 24^{2}}[/tex]

[tex]b = 4\sqrt{61}[/tex]

Lastly, the equation of the ellipse in standard form is:

[tex]\frac{x^{2}}{400} + \frac{y^{2}}{976} = 1[/tex]

Answer:

x^2/100+y^2/676=1

Step-by-step explanation:

when you are completing pythagorean theorum are you solving for the area?

Answers

Answer:

no

Step-by-step explanation: you are solving for the lengths of the different sides of the triangle

How would I solve this? Can I get steps?

Answers

Answer:

p = ± q / 5r + 8; Option D

Step-by-step explanation:

We are given the following equation; q^2 / p^2 - 16p + 64 = 25r^2;

q^2 / p^2 - 16p + 64 = 25r^2 ⇒ Let us factor p^2 - 16p + 64, as such,

p^2 - 16p + 64,

( p )^2 - 2 * ( p ) * ( 8 ) + ( 8 )^2,

( p - 8 )^2 ⇒ Now let us substitute this into the equation q^2 / p^2 - 16p + 64 = 25r^2 in replacement of p^2 - 16p + 64,

q^2 / ( p - 8 )^2 = 25r^2 ⇒ multiply either side by ( p - 8 )^2,

q^2 = 25r^2 * ( ( p - 8 )^2 ) ⇒ divide either side by 25r^2,

q^2 / 25r^2 = ( p - 8 )^2 ⇒ Now apply square root on either side,

| p - 8 | = √( q^2 / 25r^2 ) ⇒ Simplify,

| p - 8 | = q / 5r,

| p | = q / 5r + 8,

Answer; p = ± q / 5r + 8; Option D

Fiona and Pip win some money and share it in the ratio 3:1. Fiona gets £30. How much did
they win in total?​

Answers

Answer:

£40

Step-by-step explanation:

£30 represents 3 parts of the ratio that Fiona got.

Divide £30 by 3 to find the value of one part of the ratio

£30 ÷ 3 = £10 ← value of 1 part of the ratio

They won £30 + £10 = £40

HELP I NEED THIS ASAP! IF ANYONE CAN HELP ME SOLVE THIS I WOULD BE REALLY GRATEFUL!

Answers

Answer:

First, you work out the 3 and Tail from the table: T3: 62

Then you add up all values from the table:

S = 43 + 49 + 54 + 65 + 71 +62 = 344

Then the probability of next toss and spin is 3 and Tail is:

P = T3/S = 62/344 = 0.18

What is the way to best choose the answers

Answers

The B option is the correct answer
I think opinion b is the correct answer if I am wrong please tell me

Jared and Alyssa made a stack of hay bales. Each bale has a volume of 1 m3. They made 3 layers with 6 bales in each layer. A) What is the volume of the stack? _______ b) How many rows of bales could be in each layer? _______ c) How many bales could be in each row? _______

Answers

Answer:

1) 18 m^3

2) 2 rows per layer.

3) 3 bales per row.

Step-by-step explanation:

Volume of bale = 1 m^3

Layer has 3 layers tall ams 6 layers.

Total volume = 1 x 3 x 6 = 18 m^3

The most stable arrangement will be to have 2 rows of 3 bales per layer.

There could be 3 bales per row

what is 4x^2 + 12x - 6 = 0 rewritten in x^2 + b/a = -c/a format?

Answers

Answer:

Step-by-step explanation:

devide both sides by 4 it will be:

x^2 +3x -3/2 = 0

Find the length of the diagonal of an 8cmx 6cmx 10cm rectangular prism. Round to the nearest tenth. (HELP PLEASE!!)

Answers

Answer:

14.1 cm

Step-by-step explanation:

first find the base diagonal :

base di = Square root (8^2 + 6^2) = 10cm

so,

diagonal = Square root (10^2 + 10^2) = 14.1 cm (ANS)

Observe a sequência de figuras a seguir.
Considerando que a lei de formação permanecerá a mesma, a figura que ocupará a posição 53a na sequência dada, será:

Answers

Answer:

C) Equal to the figure in position 3.  

Step-by-step explanation:

Assume the sequence of figures is like the one below.

The pentagons differ in the number of stars in the sequence:

1, 2, 3, 4, 5, 1, 2, 3, 4, 5…

The sequence repeats after the fifth term.

To find the 53rd term, find the remainder for 53 ÷ 5.

53 ÷ 5 = 10, with a remainder of 3.

This tells you there are ten complete sequences (50 numbers), and three more numbers.

The 53rd term is 3, so

The figure that will occupy position 53 in the sequence is equal to the figure in position 3.

you want to start a necklace making business. You spend $0.68 on string for each necklace and $0.25 on beads for each necklace. You sell your necklaces
for $2.00 each. If you sell 30 necklaces, how much profit will you make?

Answers

Answer:

Your profit would be 32.10$

Step-by-step explanation:

You spent 20.40$ on string, then you spent 7.50$ on beads too. That adds up to 27.90$ in total, so once you make your 30 necklaces you sell them for 2.00$ let's say you sell them all in one day your coming come with 32.10$ profit. Because you put 27.90$ into making the necklaces.

Chris tried to rewrite the expression \left( 4^{-2} \cdot 4^{-3} \right)^{3}(4 −2 ⋅4 −3 ) 3 left parenthesis, 4, start superscript, minus, 2, end superscript, dot, 4, start superscript, minus, 3, end superscript, right parenthesis, cubed. \begin{aligned} &\phantom{=}\left( 4^{-2} \cdot 4^{-3} \right)^{3} \\\\ &=\left( 4^{-5} \right)^{3}&\text{Step } 1 \\\\ &=4^{-2}&\text{Step } 2 \\\\ &=\dfrac{1}{4^{2}}&\text{Step } 3 \end{aligned} ​ =(4 −2 ⋅4 −3 ) 3 =(4 −5 ) 3 =4 −2 = 4 2 1 ​ ​ Step 1 Step 2 Step 3 ​ Did Chris make a mistake? If so, in which step? Choose 1 answer: Choose 1 answer: (Choice A) A Chris did not make a mistake. (Choice B) B Chris made a mistake in Step 1. (Choice C) C Chris made a mistake in Step 2. (Choice D) D Chris made a mistake in Step 3.

Answers

Answer: Chris made a mistake in step 2

(It was in Khan Academy)

Answer:

Chris made a mistake in step 2.

Step-by-step explanation:

I was solving this problem just now and I searched it up here. Now I got the answer :)

HHELP HELP PLZZ PLZ SHOW WORK PLZZZZZ

Answers

Answer:

B. 43.3

Step-by-step explanation:

Find the area of one of the triangles:

[tex]\frac{1}{2} *b*h[/tex]

[tex]\frac{1}{2} *5*4.33=10.825[/tex]

10.825*4=43.3

Answer:

B.) 43.3 square centimetres

Step-by-step explanation:

The height is 4.33 cm and the side length is 5 cm. The surface area of the net would be the sum of the areas of all the triangles, which is 4 triangles. Since they are equilateral triangles, you can multiply. Use the formula for the area of a triangle:

[tex]A=\frac{1}{2} bh[/tex]

Insert the values:

[tex]A=\frac{1}{2} *4.33*5[/tex]

Simplify:

[tex]A=\frac{1*4.33*5}{2} \\\\A=10.825[/tex]

Multiply the area of one triangle by 4:

[tex]10.825*4=43.3[/tex]

The surface area of the pyramid is [tex]43.3[/tex] [tex]cm^2[/tex]

:Done

What are the coordinates of point L?

Answers

Answer:

(1, -3)

Step-by-step explanation:

Start where the axes meet.  That is the origin (0,)

Move 1 place to the right that is the x coordinate

Move 3 places down that is the y coordinate

(1,-3)

A playground is located on a triangular piece of land. Two sides of the playground are 157 feet long and they meet at an angle of 65°. Your are hired to build a fence around the playground. Find the cost of the fencing material needed if it will cost $11.75 a foot.

Answers

Answer:

$5,671.84

Step-by-step explanation:

To find the third side, we can use the law of cosines:

c^2 = a^2 + b^2 - 2ab*cos(theta)

c^2 = 157^2 + 157^2 - 2*157*157*cos(65)

c^2 = 28463.7649

c = 168.71 feet

The perimeter of the playground is:

P = 157 + 157 + 168.71 = 482.71 feet

If each foot costs $11.75, the final cost is:

Cost = 482.71 * 11.75 = $5,671.84

The radius of a circle is 6mm. What is the area of the shaded portion of the circle.

Answers

The area of the shaded portion of the circle is [tex]\frac{29\pi}{3} \ mm^{2}[/tex]. The correct option is b) 29 π mm² got to station 3

Area of a sector

From the question, we are to determine the area of the shaded portion.

The shaded portion in the circle is the major sector.

The area of a sector is given by the formula,

[tex]A = \frac{\theta}{360 ^\circ} \times 2\pi r[/tex]

Where [tex]\theta[/tex] is the angle subtended by the sector

and r is the radius of the circle.

From the given information,

r = 6 mm

and [tex]\theta[/tex] is the angle subtended by the major sector

Therefore

[tex]\theta = 360^\circ - 70^\circ[/tex]

[tex]\theta = 290^\circ[/tex]

Putting the parameters into the formula, we get

[tex]A = \frac{290^\circ}{360 ^\circ} \times 2\pi \times 6[/tex]

Simplifying

[tex]A = \frac{29}{3} \tim\pi \ mm^{2}[/tex]

Hence, the area of the shaded portion of the circle is [tex]\frac{29\pi}{3} \ mm^{2}[/tex]. The correct option is b) 29 π mm² got to station 3

Lear more on area of a sector here: https://brainly.com/question/10090807

your garden has a perimeter of 36 feet. what is the length of missing side.​

Answers

Answer:

I think the answer is 3 for 1 length side. And in you need 12 for both length sides. So the total is 36 and one side is 12. Since it's a rectangle,you now know two side lengths since they are the same,just opposite from each other. So 12 + 12 = 24. You do 36 – 24 because you need to get the total number for length which is 12. 12 divided by 2 is 6 which is one length side. You can check by doing 6 + 6 + 12 + 12 and you get 36.

Hope this helped!

Can I get brainliest?

Someone help pleaseee

Answers

Answer:

38°

Step-by-step explanation:

All triangles have a sum of 180°

180 - (119 + 23) = missing angle

180 - (142) = missing angle

38 = missing angle

So, the missing angle has a measurement of 38°

Other Questions
What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Please help ASAP will mark brainliest Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG John and Ellen bought a big pizza. Ellen ate 2/4 of the pizza and John ate 1/3 of the pizza. How much did they eat all together? How much was left over? (Hint: 12 is the Lowest Common Denominator).(1/4 was wrong plss helppp) The following linear programming problem has been written to plan the production of two products. The company wants to maximize its profits. LaTeX: X_1=X 1 = number of product 1 produced in each batch LaTeX: X_2=X 2 = number of product 2 produced in each batch MAX: LaTeX: 150\:X_1+250\:X_2150 X 1 + 250 X 2 Subject to: LaTeX: 2\:X_1+5\:X_2\le2002 X 1 + 5 X 2 200 LaTeX: 3\:X_1+7\:X_2\le1753 X 1 + 7 X 2 175 LaTeX: X_1,\:X_2\ge0X 1 , X 2 0 How much profit is earned per each unit of product 2 produced? Can someone plz help plz brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Poems are often ambiguous because _____. Which statement best describes the impact of the dust bowl?A. consumers brought more Texas crops when Kansas crops were destroyed B. Farmers on the Great Plains could not grow crops and many left for California C. Farmers increased their use of groundwater to irrigate their crops D. Workers migrated from the cities to the countryside to help grow food If sales tax is 10 percent, and a new palr of sneakers costs$70, how much do you actually have to pay? She is the singer to watch. The infinitive in this sentence is _____ and it is working as a(n) _____ .a. the singer, adjectiveb. to watch, adverbc. to watch, adjectived. the singer, adverb Which statement is the correct solution? Davi has 75 flower seeds. He wants to plant the seeds in pots so that every seed is planted, and every pot hasthe same number of seeds. What were some reasons American settlers wanted to go to the West?Write your answer in two or three sentences. BRAINLIEST!!!What cells are used after injecting a vaccine that help us to not get sick? In the 1994 elections, Republicans won a clearmajority in states. Which of these tables lists all the possible outcomes of flipping 3 coins? (Each row represents one outcome.) Choose all answers that apply: Choose all answers that apply: The landform pictured above is _____, which has formed out of _____ and _____.O A. a glacier, snow; iceB. a glacier; ocean water, snowO C. a mountain; snow; iceOD. an iceberg; ocean water, snow