Which of these occurs in sexual reproduction but not in asexual reproduction?
a
The genetic information is identical to the parents.
b
The offspring are made of cells.
c
The genetic information comes from the parents but is not identical.
d
The offspring inherit traits from the parents.

Answers

Answer 1

Answer:

c

Explanation:

Only in asexual reproduction the genetic information is identical. Sexual produces genetics that are combination of both parents, producing non-identical offspring.


Related Questions

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

Cell differentiation causes embryonic
cells to become which of these cells? A) prokaryotic cells B) specialized cells C) stem cells

Answers

Answer c

Explanation:

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?

Answers

Answer:The two processes are CONDUCTION and CONVECTION

Explanation:

The Energy produced in the Earth core is generated by  Sun, gravitational force , radioactive decay, and the  Earth' rotation, To maintain balance in the earth, The  processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of  tectonic plates at a  constant rate.

Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous  transfer of heat energy  from the warmer mantle at  the bottom   to  the cooler  mantle  at the top While Convection currents in the core move thermal energy causing  the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and  creating a balance in the earth.

Answer:

Conduction and Convection

Explanation:

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

Which is the most likely result if the Ubx gene was activated either before or after it normally is activated in the sequence of Hox gene expression?


A. The insect develops slightly shorter or longer abdominal legs.

B. The insect develops normal body parts at either a slower or more rapid rate.

C. The insect develops normal body parts but in an altered time sequence.

D. The insect develops legs in other parts of its body.

Answers

Answer:

D. The insect develops legs in other parts of its body.

Explanation:

HOX genes, also known as homeotic genes, are evolutionarily conserved genes (containing homeobox sequences) that encode master regulators of embryonic development in animals. Hox genes modulate the body plan of an embryo along the head-tail axis. In general, these genes are arranged in the same order as they are transcriptionally expressed along the anteroposterior body axis. Moreover, Ultrabithorax (Ubx) is a Hox gene that is responsible for the proper development of the third thoracic segment in insects. In Drosophila, it has been shown that different segments of the leg regulate their size in response to Ubx expression.

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Other Questions
Help please? Im stuck.Just say A, B, C, or D. Thanks! the process by which the characteristics of a species change over many generations in response to the environmentvariationvariationadaptationadaptationnatural selection natural selection Evolution Arc CD is [tex]\frac{2}{3}[/tex] of the circumference of a circle. What is the radian measure of the central angle?a.) [tex]\frac{2\pi}{3}[/tex]b.) [tex]\frac{3\pi}{4[/tex]c.) [tex]\frac{4\pi }{3}[/tex]d.) [tex]\frac{3\pi}{2}[/tex] The student wants to test the conductivity of each solution. Prior to carrying out the investigation, the student needs to identify the variables being controlled and the variables being changed between the two solutions. Which identification of the variables is correct?Options:The volume of the solution and the concentration of the solution are being changed between the two solutions, but the number of solute particles is being held constant.The number of solute particles and the concentration of the solution are being changed between the two solutions, but the volume is being held constant.The number of solute particles is being changed between the two solutions, but the volume and concentration of the solution is being held constant.The volume of the solution and the number of solute particles are being changed between the two solutions, but the concentration of the solution is being held constant. Two sides of a triangle have lengths of 120 cm and 95 cm.Which could NOT be the length of the third side?A. 25 cmB. 70 cmC. 95 cmD. 210 cmIM GIVING BRAINLIEST Tano Company issues bonds with a par value of $82,000 on January 1, 2020. The bonds' annual contract rate is 7%, and interest is paid semiannually on June 30 and December 31. The bonds mature in three years. The annual market rate at the date of issuance is 8%, and the bonds are sold for $79,849. 1. What is the amount of the discount on these bonds at issuance Need help getting the answer to the question below. English EssayYour friend has won a gold medal at a provincial sports tournament.Write a letter to congratulate him on the achievement Please PLEASE HELP ASAPA student placed four objects on a plastic tray: a rock, an eraser, a wood block, and an ice cube. The student slowly lifts the tray and measures the height at which each object begins to slide in order to compare the friction of each object. The table above shows the results. In a separate experiment the student used the same objects and tray, but glued a piece of gritty sandpaper to the tray. What results would be expected? A) The items would slide faster at the same heights. B) The items would start to slide when the tray is not lifted as high. C) The items would not slide at all, no matter how high the tray is raised. D) The tray would need to be raised higher before the items start to slide. 2. PART B: Which detail from the text best supports theanswer to Part A?O A "The protest movement in Shanghai, intense earlierin the week, seemed to be losing steam in the lastday or two, particularly as city officials andnewspaper editorials warned of strict measuresagainst those who continue to disturb 'publicorder." ( Paragraph 7)OB "Hundreds of people immediately rushed tosurround the trucks, waving their arms at them toleave." ( Paragraph 9)C "students have put up posters containinghandwritten transcripts of accounts of theTiananmen crackdown given by the Voice ofAmerica and the BBC in which soldiers aredescribed as having fired indiscriminately atunarmed demonstrators" ( Paragraph 17)OD "Then, he drew a finger across his throat to indicatehis belief that the Government will eventuallyembark on a nation-wide crackdown to quell showsof popular disaffection." ( Paragraph 24) Summarize Csikszentmihalyi's argument of FLOW Which overall chemical equation is obtained by combining these intermediate equations? Find the percent of the number. 25% of 50 is Is this relationship proportional or non proportional What did the Homestead Act declare (say)? Explain any issues people may have had with it? What were the main ways that Americans moved west? An earlier study determined that 60% of women older than age 50 have annual mammograms. To see if this proportion is still valid, we send surveys to 1000 women older than age 50. Of the 100 who respond, 70 say they have annual mammograms. What is the (estimated) current proportion of women older than age 50 who say they get annual mammograms Speed and time play a major factor in:ScrimmageTactical movementSituation awarenessDrill Sides or angles with the same measure are congruent. True or false 60 points!!!!how did poor whites view the newly freed black people?