Which of these is NOT an example of biting and chewing insect?

(A)

Locust



(B) Grasshopper

(C)

Aphid

(D) Termite

(E)

Answers

Answer 1

Answer:

C aphid is the answer for that question

Answer 2

Answer:

yes

Explanation:


Related Questions

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

what are the methods used in biodegrable waste managment? plz amswer i will give brainliest if u answer im using my last points​

Answers

Answer:

The different types of waste are urban, industrial, agricultural, biomedical, and radioactive wastes.

Methods used within biodegradable waste management are composting, landfilling, incineration, recycling and plasma gasification.

Explanation:

Answer:

Composting. Since biodegradable or organic wastes like vegetable peels, waste food, leaves, dead flowers, and egg shells can be recycled, they are converted into manure by burying them in compost pits.

Explanation:

What are intermediate species? in an easy way to understand. And some examples?

Answers

Answer:

An intermediate is a species which appears in the mechanism of a reaction, but not in the overall balanced equation. Examples: Amphibian/land vertebrate (Pederpes)- Intermediate form between primary aquatic Upper Devonian amphibians and early tetrapods. Lizard/snake (Pachyrhachis)—Intermediate form of snakes and an extinct lizard-like reptile. It was a primitive snake with limbs.

Explanation:

Answer: These are certain species that create “connecting links” or something like that, between the fossil record of life which help to show the slow process of speciatin.

[speciatin- the formation of new and distinct species in the course of evolution.]

Hope this helped! <3

If Sammi had more time or better resources, how could she improve her model to eliminate some of the weaknesses?

Answers

Answer:

She could use more materials to replicate the entire digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

answer for plato activity, your welcome :)

Answer: She may utilize additional materials to duplicate the full digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

Which statements accurately describe the roles of water on earth

Answers

Answer:

C.

Explanation:

It carries cold water from the equator to the poles

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

After school, Kai feels hungry and tired. He finds some sugar cookies in the cabinet and finishes the whole package.
Which statements best describe the role of glucagon and insulin in this scenario?
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. Insulin
was secreted after he ate the cookies because his blood glucose was high.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. Glucagon
was secreted after he ate the cookies because his blood glucose was high.
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he
ate, insulin from the cookies increased his blood sugar levels.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he ate,
glucagon from the cookies increased his blood sugar levels.

Answers

Answer: Option A) Glucagon was secreted by his pancreas before he ate the cookies because blood glucose was low. Insulin was secreted after he ate the cookies because his blood glucose was high.

Explanation:When Kai was hungry and his blood glucose level was decreasing, glucagon is the hormone which was secreted by the islets of pancreas to increase the blood sugar levels in his body. Glucagon forces the liver to release the stored glucose in it, which increases the blood glucose level in the body. When Kai ate the sugar cookies there was enough of blood glucose available for his body, also it exceeded the requirement and went high. Insulin was then secreted to control this excess glucose from the islets of pancreas. As it helps the body cells to absorb the glucose and lowers the amount of glucose in the blood. It makes the cell available with the glucose to produce energy and perform their activities.

In short, glucagon and insulin both are secreted by the same organ which is islets of pancreas. But they differ in their function, glucagon increases the blood glucose when the body needs it, whereas insulin helps to absorb the excessive glucose and stores that in the body. Both are the hormones which help in regulating the body glucose levels.

During  process of digestion which takes place in digestive tract statement which describes role of glucagon and insulin is glucagon was secreted by  pancreas before he ate the cookies because his blood glucose was low. Insulin was secreted after he ate cookies because his blood glucose was high.

What is digestive tract?

It consists of the gastrointestinal tract along with the accessory organs which are present in digestion process . It involves the breakdown of complex food into smaller components which can be easily assimilated and absorbed by the body.

The digestion process has 3 phases: cephalic phase , gastric phase and intestinal phase.Cephalic phase begins with secretion of gastric juices from gastric glands in response to sight and smell of food.It involves chewing and chemical breakdown of food by the action of digestive enzymes ,saliva in the mouth contain enzymes like lipase and amylase which are secreted by the salivary and serous glands present on the tongue.

Learn more about digestive tract,here:

https://brainly.com/question/28163067

#SPJ2

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin


1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

1. ____Bacteria are the only microorganisms used in the fermentation process 2. ____Fermentation can be used only to make dairy products 3. ____Starter cultures are used to initiate the process of fermentation in modern day food processing 4. ____Fermentation occurs when undesirable metabolic reactions allow for the growth of pathogens or the presence of unwanted microorganisms in food

Answers

Please sort the following statements as being true or false regarding fermentation and its role in food production. Please recall the role that microorganisms can play in the production of foods.

Answer:

1.  False statement

2.  False statement

3.  True statement

4.  False statement

Explanation:

1. Yeast is a microorganism which is also used in fermentation process.

2. Fermentation can however be used for various reasons, including: development of flavours, preservation and enrichment of foods, reduction of food cooking time etc.

3. Starter culture is considered to be a form of microbiological process which is used to initiate a process of fermentation.

4. Fermentation is considered to be a desired action of microorganisms

Statement that Bacteria are regarded as only microorganisms utilized in fermentation process is False

Statement that Fermentation is considered only when making dairy products is False.

Statement that Starter cultures can be utilized when initiating the fermentation process in food processing in this age is True.

Statement that Fermentation takes place when growth of pathogens or unwanted microorganisms in food are allowed by undesirable metabolic reactions is False.

Fermentation can be regarded as metabolic process whereby  organism converts a carbohydrate into alcohol or an acid.

This process is used in making dairy products, one of the organisms that can be used in fermentation is yeast.

Learn more at:

https://brainly.com/question/13050729?referrer=searchResults

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

In the database, Academic Search Complete (Links to an external site.), search for the article "Brevetoxicosis: Red Tides and Marine Mammal Mortalities" by Flewelling et al. If you wanted to explore more of the scholarly conversation by taking advantage of "citation chaining" what links could you click on to help with this task

Answers

Answer: The link I would be clicking on with this task is Molecular detection of the brevetoxin-producing dinoflagellate Karenia brevis and closely related species using rRNA-targeted probes and a semiautomated sandwich hybridization assay. Therefore, the task will be accomplished having done this.

What has a greater influence on protein levels?

Answers

Answer:

B : mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced.

Explanation:

Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up a polyphyletic group. an ingroup, with species U as the outgroup. a paraphyletic group. a monophyletic clade. a valid taxon.

Answers

Answer:

Explanation:

Creative Bioarray has developed and validated the 3T3 neutral red uptake photoxicity assay, erythrocyte hemolysis assay and a phototoxicity screening assay using 3D human epidermis model.

https://dda.creative-bioarray.com/pharmacology-models.html

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Which function is specific to the neuron? It generates electrochemical signals so that the body can react to stimuli. It produces antibodies to destroy pathogens for protection purposes. It breaks down chemical substances into a form that is usable by the body. It delivers oxygen to the cells of the body for metabolic processes.

Answers

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

This is the job of the nervous system; it allows our body to react to stimuli. Neurons are what allows us to feel if something is touching our body (or if we are touching something) by sending synapses all the way to the brain at an incredibly fast pace.

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

edge 2022

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Other Questions
Define, and identify the differences between a real estate broker, real estate associate broker, and real estate salesperson. Help!!!!!!! Thank you!!!!!!! Seismic attenuation and how spherical spreading affect amplitude, can anyone explain this please! Which of the following are assumptions of the sustainable (self-supporting) growth model? Check all that apply. The firm maintains a constant net profit margin. The firms liabilities and equity must increase at the same rate. The firm pays no dividends. The firm maintains a constant ratio of liabilities to equity. Jolly Company produces hula hoops. Jolly Company has the following sales projections for the upcoming year: First quarter budgeted hula hoop sales in units Second quarter budgeted hula hoop sales in units Third quarter budgeted hula hoop sales in units Fourth quarter budgeted hula hoop sales in units Jolly Company wants to have % of the next quarter's sales in units on hand at the end of each quarter. Inventory at the beginning of the year was hula hoops. How many hula hoops should Jolly Company produce during the first quarter? Which examination technique is the visualization of body parts in motion by projecting x-ray images on a luminous fluorescent screen? Which value would complete the last cell?(1 point)3.0100.025.04.0 The ratio of boys to girls in the ninth grade is 7 to 9. there are 218 girls set up a proportion to model this information what are the origins of Islam and the life and teachings of muhammad TB MC Qu. 8-174 LBC Corporation makes and sells ... LBC Corporation makes and sells a product called Product WZ. Each unit of Product WZ requires 2.0 hours of direct labor at the rate of $16.00 per direct labor-hour. Management would like you to prepare a Direct Labor Budget for June. The company plans to sell 39,000 units of Product WZ in June. The finished goods inventories on June 1 and June 30 are budgeted to be 610 and 110 units, respectively. Budgeted direct labor costs for June would be: Consider the circle of radius 10 centered at the origin. Find an equation of the line tangent to the circle at the point (6, 8) why do solids have a fixed shape In situations where rivals can readily copy the successful features of a company's strategy or duplicate its attempts to attract customers, the only dependable path to competitive advantage is for a company to staff the company's organization with smarter and more talented people. outexecute rivals by developing a collection of resources and capabilities that enables the company to perform certain important value chain activities at lower cost than rivals or with greater effectiveness than rivals (thereby gaining the ability to deliver more value to customers via either a lower price or a more appealing product). do a better job of training, empowering, motivating, and compensating employees than rivals. perform value chain activities quicker or faster than rivals can. outsource more value chain activities than rivals do and thereby achieve lower operating costs. Determine whether Rolle's Theorem can be applied to f on the closed interval [a, b]. f(x) = x2 + 3x, [0, 3] Yes, Rolle's Theorem can be applied.No, because f is not continuous on the closed interval [a, b].No, because f is not differentiable in the open interval (a, b).No, because f(a) f(b). If Rolle's Theorem can be applied, find all values of c in the open interval (a, b) such that f'(c) = 0. (Enter your answers as a comma-separated list. If Rolle's Theorem cannot be applied, enter NA.) c = Countess Corp. is expected to pay an annual dividend of $4.63 on its common stock in one year. The current stock price is $74.11 per share. The company announced that it will increase its dividend by 3.75 percent annually. What is the company's cost of equity? is 1+isqrt3 a complex number Rinaldo wants to know how you recorded the part cash and part credit purchase that occurred during the beginning of May in Sage 50. Rinaldo asks which of the following shows the correct series of actions to open a Sage 50 window that must be used to record the above transaction:Inventory & Services Enter Bills New BillInventory & Services Purchase Invoice New InvoiceVendors & Purchases Enter Bills New BillVendors & Purchases Purchase Invoice New Invoice Presented below are the ending balances of accounts for the Kansas Instruments Corporation at December 31, 2021.Account Title Debits CreditsCash $40,000 Accounts receivable 170,000 Raw materials 44,000 Notes receivable 120,000 Interest receivable 23,000 Interest payable $25,000 Investment in debt securities 52,000 Land 70,000 Buildings 1,700,000 Accumulated depreciationbuildings 640,000 Work in process 62,000 Finished goods 109,000 Equipment 340,000 Accumulated depreciationequipment 150,000 Patent (net) 140,000 Prepaid rent (for the next two years) 80,000 Deferred revenue 56,000 Accounts payable 200,000 Notes payable 600,000 Restricted cash 100,000 Allowance for uncollectible accounts 33,000 Sales revenue 1,200,000 Cost of goods sold 470,000 Rent expense 48,000 Additional Information:1. The notes receivable, along with any accrued interest, are due on November 22, 2022.2. The notes payable are due in 2025. Interest is payable annually.3. The investment in debt securities consist of treasury bills, all of which mature next year.4. Deferred revenue will be recognized as revenue equally over the next two years.Required:Determine the companys working capital (current assets minus current liabilities) at December 31, 2021. Menlo Company distributes a single product. The companys sales and expenses for last month follow: Total Per unitSales $314,000 $20Variable expenses 219,800 14Contribution margin 94,200 6 Fixed expenses 75,000Net operating income 19,200Required: a. What is the monthly break-even point in unit sales and in dollar sales? b. Without resorting to computations, what is the total contribution margin at the break-even point? c. How many units would have to be sold each month to attain a target profit of S27,600? d. Verify your answer by preparing a contribution format income statement at the target sales level. e. Refer to the original data. Compute the company's margin of safety in both dollar and percentage terms. f. What is the company's CM ratio? If sales increase by $76,000 per month and there is no change in fixed expenses, by how much would you expect monthly net operating income to increase? In a(n) __________, the subject comes before the verb.(1 point) 1 singular noun 2 standard sentence 3 inverted sentence 4 prepositional phrase