Which of the following statements is false?

Glycolysis does not require molecular oxygen
Alcoholic fermentation does not require molecular oxygen
Lactic fermentation does not require molecular oxygen
Oxidative phosphorylation does not require molecular oxygen

Answers

Answer 1

Answer:

Lactic fermentation does not require molecular oxygen

Explanation:

I think its this because I nevr heard that lactic fermentation needs molecular oxeygen??


Related Questions



A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent

Answers

Answer:

B. DENSITY INDEPENDENT

Explanation:

Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.

John Needham, Louis Pasteur, and other scientists all performed experiments to disprove ______.
a) spontaneous generation
b) evolution
c) Koch's postulates
d) binomial nomenclature

Answers

Answer:

A) spontaneous generation

Explanation:

Spontaneous Generation theory stated that living organisms could be spontaneously generated from non-living matter. Francesco Redi conducted an experiment similar to the one Louis Pasteur would do nearly 200 years later. The 17th-century Italian developed a spontaneous generation experiment that showed that maggots do not spontaneously emerge from decaying meat.

MARK THIS ANSWER BRAINLIEST PLEASE ❤️

The theory of spontaneous generation is an experiment that tries to prove the possibilities that living organisms can be produced from non-living origins.

This experiment was first done by Francesco Redi in 1668. However, several scientists such as John Needham, Louis Pasteur, John Tyndall amongst other scientist tried to disprove the theory of spontaneous generation.

The theory was later disproved by Louis Pasteur and John Tyndall in the mid-19th century.

Read more about spontaneous generation at:

https://brainly.com/question/2003717

Fat cells are expandable. How does this structure relate to a fat cell's function?

A) Fat cells store energy for the body to use later, so being
expandable would help with storage.

B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.

C) Fall cells protect organs, so being expandable can help with cushioning.

D) Fat cells do not expand

Answers

Answer:

Explanation:

d

Which is a positive effect of wildfires?

Answers

Answer: it lets for room for more buildings to be built

Explanation:

Hi! A positive effect of wildfires would be there is now cleared land that can be used for other projects along with other resources. I hope this helped, Goodluck :)

I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural

Answers

What are the answer choices

Whah are the types of kidney?​

Answers

Answer:

Distinct cell types include: Kidney glomerulus parietal cell. Kidney glomerulus podocyte. Kidney proximal tubule brush border cell.

System: Urinary system and endocrine system

Nerve: Renal plexus

Artery: Renal artery

Vein: Renal vein

Answer:

There are no different types of kidney. We've 2 kidneys - left kidney & right kidney.

The left kidney is longer and narrower than the right kidney. This kidney is in the direction facing the right kidney.Also the left renal volume appears approximately 146 [tex]cm^{3}[/tex] in shape, whereas the right one measures around 134

Hope it helps!

╭═══════ღ❦ღ══╮

      [tex]RainbowSalt^{2222}[/tex]

╰══ღ❦ღ═══════╯

Which of the following could occur as the result of runoff of high nitrogen fertilizers from farmlands near a lake?
O an increase in algae growth resulting in low oxygen levels in the lake
O a decrease in mineral storage reducing carbon levels of the lake
O a decrease in pollution in lower ozone levels in the lake area
O an increase in deforestation reducing animal populations in the lake area

Answers

Answer: the first one an increase in aldae

Explanation:

This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary

Answers

C. Secondary Succession

The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.

This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.

Hope it helps you! \(^ᴥ^)/

Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.

What is a succession?

Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.

Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.

Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.

Learn more about succession, here:

https://brainly.com/question/26675203

#SPJ2

ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution

Answers

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

Wich is true of Saturns satellite, Titan?

Answers

Answer:

Titan's landscape is similar to earth's and show dry rivers and hydrocarbon lakes. it is the only body in the solar system that shows evidence of surface liquid other than earth. It is the only planetary moon in the solar system which has an atmosphere which is rich in nitrogen like earth.

Answer:

it is larger than the planet murcury

Explanation:

Ella has a mass of 56 kg, and Tyrone has a mass of 68 kg. Ella is standing at the top of a skateboard ramp that is 1.5 meters tall. Which conclusion is best supported by the given information?

If Tyrone stands at the top of the same ramp, his potential energy will be less than Ella’s.
If Tyrone stands at the top of a 1 m high ramp, his potential energy will be greater than Ella’s.
If Tyrone stands at the top of the same ramp, his potential energy will be the same as Ella’s.
If Tyrone stands at the top of a 2 m high ramp, his potential energy will be greater than Ella’s.

Answers

2020 answer on the edge

Answer:

d i guess

Explanation:

Help me with this ASAP please I will mark you with Brainliest

Answers

So, electric charge can either attract or repel forces. When the objects have opposite charges (for example, one negative and one positive) those two objects will attract each other.
When the two charged objects have the same charge (for example both positive or both negative) they will repel each other.

In this case, the comb is attracting the paper so the charges contain one negative and one positive.

Your answer should be:
"When a comb picks up small pieces of paper, they attract the paper."

please help me with this ​

Answers

Answer : B) A population of wolves was introduced into Yellowstone National Park.

This is the only reasonable answer that would explain the decrease of deer, as the wolves would hunt on the deer.

Refer to the chart in Figure 10: Effects of Surface Gravity, to see what someone would weigh on different planets.


If you weighed 100 pounds on Earth, you would weigh _______ pounds on Saturn.

94.8

91.6

88.4

120.5
pleas help !!!

Answers

You would weigh 108 pounds

If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?

Answers

Answer:

True

Explanation:

Because for each death someone is born

It's like 1+1+1-1-1=1

The answer is the same

4. What does the term reflection mean?
Waves pass through an object
Waves change their shape
Waves are absorbed by the object
Waves bounce off an object

Answers

Answer:

Waves bounce off an object

Answer:

Waves bounce off an object

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Answers

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Base your answer to questions 8 and 9 on the diagram below and on your knowledge of
biology
The diagram represents a portion of a starch molecule.

8. The energy in this molecule is stored
1. in the bonds between atoms
2. when the carbon atoms break off
3. in the oxygen found in the molecule
4. when water breaks this molecule apart
9. The building blocks for this molecule are
1. amino acid
bases
2. simple sugars
3. Fats
4. molecular

Answers

In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.

Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.

In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.

On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.

Learn more about molecule in: https://brainly.com/question/19922822

In a photo-tropic experiment, young seedlings in a box were subjected to light from one direction. The seedling continue to grow erect. Which of the following statement is correct

A. Only the tip of the seedling received the light
B. The light was not strong enough
C. The seedlings were rather too young
D. The tip of the seedling may have been covered
E. The box containing the seedling should have been placed on a laboratory bench

Answers

Answer: It could be that B, that the light wasn't strong enough

Explanation:

I'm not sure, but the plant didn't grow towards the light, so that's a possible answer I saw

Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction

Answers

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

Which of the following is NOT true of fungi?

Select one:

a.
They digest their food outside of the body


b.
They recycle inorganic nutrients to photosynthesizers


c.
Each of the filaments on the body is a mycelium


d.
Fungi cells lack chloroplasts

Answers

C) because it’s not the filaments on the body is not mycelium.

The most diverse community would typically found in

Habitat 1

Habitat 2

Habitat 3

Non of the above

Answers

Answer:

None of the above

Mark me as brainliest ❤️ please

Plyometrics can help a person maintain cardiorespiratory fitness true or false

Answers

False
Explanation: Edge

How many moles of NaCl are in 200 grams?

Answers

Answer:

3.42 moles

Explanation:

Molar mass of NaCl= 58.4 g/mol

Number of moles in 20g of NaCl is

200.0/58.4  = 3.42 moles

The sun is a natural resource used by people. Why is the sun considered a renewable resource? *

the sun goes away at night and then comes back in the morning
on cloudy days, the sun cannot be used
solar energy from the sun is limited
the sun is an unlimited source of energy that isn't used up as fast as people use it

Answers

Answer:

Because the earth continuously receives solar energy from the sun, it is considered a renewable resource.

Explanation:

What is flight initiation distance FID

Answers

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3

The quickest rate at which a population can grow is its ___________________________.

Answers

I believe it is its reproduction rate

what type of food is made during photosynthesis

Answers

Answer:

glucose

Explanation:

Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light

(bbc)

glucose
Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light.

During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:

a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over

Answers

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?

Answers

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

Other Questions
solve for x in parts below: Which practical steps can we take to end Gender-Based Violence? Industrialization:Question 2What is the term for when people move from rural areas to cities?Select one:O CorporationDynamoTenementUrbanization change the following into mixed fraction 13/5 Suppose that you add 29.2 g of an unknown molecular compound to 0.250 kg of benzene, which has a K f of 5.12 oC/m. With the added solute, you find that there is a freezing point depression of 2.78 oC compared to pure benzene. What is the molar mass (in g/mol) of the unknown compound What is the mean?-1 -1 -4 -5 -4 -4 -7 -8 A power company calculates a person's monthly bill from the number ofkilowatt-hours (kWh), x, used.The function b(x) = {0.15x,x < 2000.10 (x - 200) + 30, 2 > 200determinesthe bill.How much is the bill for a person who uses 700 kWh in a month?A. $100B. $80O C. $105O D. $95PREVIOUS FabFitFun Coupon Code FabFitFun Coupon Code is the best way to avail discounts on FabFitFun store shopping, there are lots of items on which you can avail the discount, amazing offers so visit the store by clicking the button and Save your Pocket now! FabFitFun Coupon Code https://couponsagent.com/front/store-profile/fabfitfun-coupon-code what is electricity ? if f(x)=3x+2 what is f(5)? PLS HELP TIMES TEST I HAVE 49 MINUTES LEFT AND THERES 41 QUESTIONS IM ON 14 what is meant by women education You have really done a wonderful job. I recommend you...quit it * O should O shouldn't O should have O shouldn't have COMPLETE THE WORKSHEET Which step in the construction of copying a line segment ensures that the new line segment has the same length as the original lie segment? Two sides of a triangle are perpendicular. If the two sides are 8cm and 6cm, calculate correct to the next degree, the smallest angle of the triangle. (A)35 (B)36 (C)37 (D)38 (E)53 2 + (-17) i need the correct answer and show your work Determine two pairs of polar coordinates for the point (5, -5) with 0 < 360. When alcohol and cocaine are combined, the effects of both are ...A. quickened.B. canceled.C. prolonged. graph y > 1 - 3x whats the answer please