Which of the following questions is the most testable through scientific experimentation? Will mark brainliest, plz help A. which gelatin takes longer to set: gelatin with fruit or gelatin without fruit B. Which fruit looks more attractive in gelatin: bananas or apples C. Which tastes better: gelatin with fruit or gelatin without fruit D. Which fruit do more people buy in one year: bananas or apples

Answers

Answer 1

Answer:

Which gelatin takes longer to set: gelatin with fruit or gelatin without fruit.

Explanation:


Related Questions

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

What are intermediate species? in an easy way to understand. And some examples?

Answers

Answer:

An intermediate is a species which appears in the mechanism of a reaction, but not in the overall balanced equation. Examples: Amphibian/land vertebrate (Pederpes)- Intermediate form between primary aquatic Upper Devonian amphibians and early tetrapods. Lizard/snake (Pachyrhachis)—Intermediate form of snakes and an extinct lizard-like reptile. It was a primitive snake with limbs.

Explanation:

Answer: These are certain species that create “connecting links” or something like that, between the fossil record of life which help to show the slow process of speciatin.

[speciatin- the formation of new and distinct species in the course of evolution.]

Hope this helped! <3

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

how can evidence from an experiment in relationship to the hypothesis ​

Answers

Answer:

The Hypothesis is a prediction based on the theory being tested.

The evidmence can support the Hypothesis or invalidate the Hypothesis.

Explanation:

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin

Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up a polyphyletic group. an ingroup, with species U as the outgroup. a paraphyletic group. a monophyletic clade. a valid taxon.

Answers

Answer:

Explanation:

Creative Bioarray has developed and validated the 3T3 neutral red uptake photoxicity assay, erythrocyte hemolysis assay and a phototoxicity screening assay using 3D human epidermis model.

https://dda.creative-bioarray.com/pharmacology-models.html

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Which function is specific to the neuron? It generates electrochemical signals so that the body can react to stimuli. It produces antibodies to destroy pathogens for protection purposes. It breaks down chemical substances into a form that is usable by the body. It delivers oxygen to the cells of the body for metabolic processes.

Answers

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

This is the job of the nervous system; it allows our body to react to stimuli. Neurons are what allows us to feel if something is touching our body (or if we are touching something) by sending synapses all the way to the brain at an incredibly fast pace.

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

edge 2022

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

After school, Kai feels hungry and tired. He finds some sugar cookies in the cabinet and finishes the whole package.
Which statements best describe the role of glucagon and insulin in this scenario?
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. Insulin
was secreted after he ate the cookies because his blood glucose was high.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. Glucagon
was secreted after he ate the cookies because his blood glucose was high.
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he
ate, insulin from the cookies increased his blood sugar levels.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he ate,
glucagon from the cookies increased his blood sugar levels.

Answers

Answer: Option A) Glucagon was secreted by his pancreas before he ate the cookies because blood glucose was low. Insulin was secreted after he ate the cookies because his blood glucose was high.

Explanation:When Kai was hungry and his blood glucose level was decreasing, glucagon is the hormone which was secreted by the islets of pancreas to increase the blood sugar levels in his body. Glucagon forces the liver to release the stored glucose in it, which increases the blood glucose level in the body. When Kai ate the sugar cookies there was enough of blood glucose available for his body, also it exceeded the requirement and went high. Insulin was then secreted to control this excess glucose from the islets of pancreas. As it helps the body cells to absorb the glucose and lowers the amount of glucose in the blood. It makes the cell available with the glucose to produce energy and perform their activities.

In short, glucagon and insulin both are secreted by the same organ which is islets of pancreas. But they differ in their function, glucagon increases the blood glucose when the body needs it, whereas insulin helps to absorb the excessive glucose and stores that in the body. Both are the hormones which help in regulating the body glucose levels.

During  process of digestion which takes place in digestive tract statement which describes role of glucagon and insulin is glucagon was secreted by  pancreas before he ate the cookies because his blood glucose was low. Insulin was secreted after he ate cookies because his blood glucose was high.

What is digestive tract?

It consists of the gastrointestinal tract along with the accessory organs which are present in digestion process . It involves the breakdown of complex food into smaller components which can be easily assimilated and absorbed by the body.

The digestion process has 3 phases: cephalic phase , gastric phase and intestinal phase.Cephalic phase begins with secretion of gastric juices from gastric glands in response to sight and smell of food.It involves chewing and chemical breakdown of food by the action of digestive enzymes ,saliva in the mouth contain enzymes like lipase and amylase which are secreted by the salivary and serous glands present on the tongue.

Learn more about digestive tract,here:

https://brainly.com/question/28163067

#SPJ2

What is the purpose of the Synthesis (S) phase of the cell cycle?
A. Create a copy of the cell
B. Synthesize extra organelles
C. Duplication of RNA
D. Duplication of DNA

Answers

The answer is letter C

The purpose of the Synthesis (S) phase of the cell cycle is the duplication of DNA. The correct option is D.

What is the cell cycle?

A cell cycle is a process of dividing a cell into two cells. It is a four-stage process that includes increasing the cell, diving the DNA, and the ready for cell dividing and then dividing into two cells.

The S phase is the synthetic phase. The phase includes duplication of DNA and dividing of DNA. During cell division or DNA replication, this process occurs.

So, all other statements are false, in the S phase, the DNA duplicates in the nucleus and the cell will ready to duplicate for cell division and mitosis. It is one of the processes of cell division or DNA replication.

Thus, the correct option is D. Duplication of DNA.

To learn more about the cell cycle, refer to the link:

https://brainly.com/question/12277305

#SPJ5

In the database, Academic Search Complete (Links to an external site.), search for the article "Brevetoxicosis: Red Tides and Marine Mammal Mortalities" by Flewelling et al. If you wanted to explore more of the scholarly conversation by taking advantage of "citation chaining" what links could you click on to help with this task

Answers

Answer: The link I would be clicking on with this task is Molecular detection of the brevetoxin-producing dinoflagellate Karenia brevis and closely related species using rRNA-targeted probes and a semiautomated sandwich hybridization assay. Therefore, the task will be accomplished having done this.

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

Shannon is making a Venn diagram to organize the characteristics of cell walls and cell membranes. Which pair of characteristics both belong in the two areas of the Venn diagram that do not intersect?

helps with communication; contains mostly cellulose
contains mostly cellulose; forms the outer layer of animal cells
is found in plant cells; is found in animal cells
is semipermeable; found in animal cells

Answers

Answer:the answer is the second

Because cell wall made up of most cellulose while cell membrane the outer if the animal cell

Answer:

B.

contains mostly cellulose; forms the outer layer of animal cells

Explanation: just took the test(❁´◡`❁)

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

If Sammi had more time or better resources, how could she improve her model to eliminate some of the weaknesses?

Answers

Answer:

She could use more materials to replicate the entire digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

answer for plato activity, your welcome :)

Answer: She may utilize additional materials to duplicate the full digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus
Other Questions
Please answer ASAP. The question is down below An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? A car can cover a distance of 522 km on 36 liters of petrol. How far can it travel on 14 liters of petrol? help i want help i want help "Net income for the period was $200,000. The retained earnings account had a beginning balance of $25,000. If the company paid dividends of $20,000 during the year, what is the ending balance in retained earnings?" T en la clase de ciencias con tu prima ngela? HELPPP MEEE Ying was planning how to seat guests at a dinner. There were between 50 and 100 people coming. Ying noticed that they could be seated with 8 people to a table and no seats left empty. She also noticed that they could be seated with 12 people to a table with no seats left empty. How many people were coming? Help!!How are all forms of asexual reproduction similar?A. The offspring have identical DNA to the parent.B. The offspring have different DNA than the parent.C. They all require two parents to reproduce.D. The offspring have diversified DNA in order to surviveAlso explain why the answers are correct/incorrect. The most powerful of the five competitive forces is usually: Select one: a. The competitive pressures that stem from ready availability b. The competitive pressures associated with rivalry among competing sellers in the industry for buyer patronage c. The competitive pressures associated with the potential entry of new competitors d. The bargaining power and leverage that large customers are able to exercise Which statement about modern Israel is most accurate?O It is made up only of Jewish people.O It is the homeland for Jewish people.It has been a Jewish holy site for fifty years.O It features modern beliefs and rejects the past. A compound that has a sea of delocalized electrons has what type of bonding? The value obtained when a buyer pays cash or its equivalent, the buyer and seller are unrelated, the buyer and seller are informed consumers, and the property has been on the market for a reasonable amount of time is called: Which country played the biggest role at the beginning of the Atlantic slave trade?Oa.) Spainb.) HollandC.) PortugalaOd.) EnglandBetheSUBMIT MY ANSWER Qu pueblo indoeuropeo es autor de una serie de leyendas y cuentos folclricos que, segn se cree, dieron origen a la novela de caballera en la Edad Media? WILL GIVE BRAINLIEST PLZ!!! What was the Great Compromise (AKA Connecticut Compromise)? C-Spec, Inc., is attempting to determine whether an existing machine is capable of milling an engine part that has a key specification of 4 .003 inches. After a trial run on this machine, C-Spec has determined that the machine has a sample mean of 4.001 inches with a standard deviation of .002 inch. Calculate the Cpk for this machine. Expand the following using the Binomial Theorem and Pascals triangle. Show your work. (x + 2)6 (x 4)4 (2x + 3)5 (2x 3y)4 In the expansion of (3a + 4b)8, which of the following are possible variable terms? Explain your reasoning. a2b3; a5b3; ab8; b8; a4b4; a8; ab7; a6b5 What is the volume of a rectangular prism with a length, width,215and height ofcm, -cm, andcm, respectively?346 If Jim Roller can paint a room in 3 hours while John Brush would take 5 hours, how long will they take if they work together? The underlined words and phrases have strong negative, Tatian. How do they support the authors purpose? Children of the drug wars