Which of the following organisms can be used by humans for selective breeding? Choose all that apply.

15 points btw

Which Of The Following Organisms Can Be Used By Humans For Selective Breeding? Choose All That Apply.

Answers

Answer 1

Answer:

All of the above.

Explanation:

Selective breeding is the process by which humans use animal breeding and plant breeding to selectively develop particular phenotypic traits by choosing which typically animal or plant males and females will sexually reproduce and have offspring together.

Answer 2
All of the above :)










Related Questions

Is the thermos considered a conductor or insulator?

Answers

Answer:

no

Explanation:

Insulator is the answer

callme 9473242403 0nly g​

Answers

what would we talk about bae?

Answer:

you mean guys or gils hmm

Explanation:

cohesion is a property water.Which of the following is NOT an example of cohesion

a.water is attracted to the sides of a glass cylinder
b.water strider can walk on water
c.water forming a drop on a penny
d.water molecules are attracted to each other

Answers

Answer:

A po kasi nga kapag ang tubig ay naisalin sa isang baso minsan ang tubig ay dumidikit sa baso tama diba kaya naman ang sagot ay A baka naman brainliest naman jan:)

Water is attracted to the sides of a glass cylinder is an example of cohesion.

What do you mean by cohesion?

Cohesion means sticking together. If your group of friends heads to the lunchroom as a team and sits all together, you're demonstrating strong cohesion.

Cohesion allows for the development of surface tension, the capacity of a substance to withstand being ruptured when placed under tension or stress.

Cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces thanks to their ability to form hydrogen bonds with one another.

Learn more about cohesion:

https://brainly.com/question/29598400

#SPJ2

anyone know the answer??????????????????????????????????

Answers

Answer:

The first one is the answer

Explanation:

Kingdom: Animal

Genus: Leucocephalus

Species: Haliaeetus

If the DNA sequence is GCTCAATTCGACCTA, the complementary RNA
sequence created during transcription is

Answers

Answer:

CGAGTTAAGCTGGAT

Explanation:

thymine pairs with adenine and guanine pairs with cytosine

T-A

G-C

There are 450 calories in 100 g of trail mix. If you burn 30 calories in 10 minutes of walking, how much trail mix should you eat to replenish the energy you spend walking for 2 hours?

Answers

Answer:

to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

Explanation:

Firstly, let us calculate the number of calories burnt in 2 hours

in 10 minutes; 30 calories are burnt

∴ in 1 minute 30/10  calories are burnt = 3 calories are burnt

2 hours = 120 minute

∴ in 120 minutes 3 × 120 = 360 calories are burnt.

Next, let us calculate the amount of trail mix that contains 360 calories

100g of trail mix = 450 calories

450 calories = 100 g

1 calory = 100/450

∴ 360 calories = 360 × (100/450)

=  360 × 0.222 = 80g

∴ to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

HELP IT DUE NOW !!!!!!!!!!!!!!!
An area that is in the early stages of secondary succession will typically contain

rock lichens.

evergreen trees.

perennial shrubs.

annual grasses.

Answers

Perennial Shrubs I know it is late.

Which one is the true answer

Answers

Answer:
B
Explaination:

The diagram below represents the circulation of air above Earth's surface at a coastal location during the day and at night.
This local air movement is best described as an example of
1.
conduction between Earth's surface and the atmosphere above it
2.
condensation of water vapor during the day, and evaporation of water during the night
3.
convection resulting from temperature and pressure differences above land and water
4.
greater radiation from the warmer ocean during the day and from the warmer land at night
Submit Answer

Answers

Answer:

3. convection resulting from temperature and pressure differences above land and water

Explanation:

Due to the the difference between the ability of land and to water to absorb and radiate heat energy, the land gets heated up by the sun more quickly than water during the hot afternoons. As a result, the air above the land surface gets heated up more quickly than that above water. Warm air being less dense than cold air will rise above to atmosphere creating a low pressure area on land. On the other hand, air above water is not heated up as quickly, thus the dense cooler air over water will rush in and replace the warm air that has risen above the land surface.

At night, the land cools off more easily than water, hence the air above the land surface is cooler. On the other, water does not lose heat as quickly as the land, hence the air above the water surface is warmer than that over land. Warm air over the water surface will rise above, while colder air from land will replace it.

what is formed during photosynthesis​

Answers

Answer:

Glucose and oxygen is produced

Explanation:

oxygen is usually released as a by-product and the glucose made is converted to starch and stored in leaves

plus ATP molecules are formed from excess light energy and is converted to a high energy chemical compound

What's does the term origin time mean in earth science

Answers

Answer:

Well depending on context it can mean different things, I could mean one of these three thing, choose the one you think is the most suitable,

(1) The birth, existence, or beginning; starting point. (2) The cause; that which causes something to arise. (3) That which acts as the source or that which from where something is derived.

In pea plants, yellow pea color (Y) is dominant over green pea color (y).
What would the phenotype be if the genotype is Yy.

Answers

Answer:

So we know that yellow pea is dominant over green pea

then offspring might be 75% yellow pea and 25% green pea. Since yellow pea is dominant I feel like it will still be Y because its dominant

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

When a blood clot breaks free and blocks a vessel leading to the brain a _______________________ can happen.

Answers

Answer:

a stroke can happen

Explanation:

A stroke can happen, right?

Can someone help me with his please?

Answers

4N to the left
5N to the left
0N
9N to the right

High levels and long periods of stress can increase a person's risk for many diseases
True
False​

Answers

Answer:

This is true many people can get many diseases from stress.

Answer:

True, go on this for your assessment  I commented on ur other post too, https://quizlet.com/341036936/chapter-11-lesson-3-flash-cards/

Explanation:

match the following
(i) Stem tuber (a) minerals

(ii) Conditioned Reflex (b) Blue green algae

(iii) Blood Circulation (c) potato

(iv) Pancreas (d) chlorosis

(v) Autotrophs (e) Pavlov's Experiment

(vi) Active transport (f) Insulin

(g) William Harvey​

Answers

Answer:

Stem tuber ---- Potato

Conditioned reflex ---- Pavlov's experiment

Blood circulation ---- William harvey

Pancreas ---- Insulin

Autotrophs ------ Blue green algae

Active transport ---- Minerals

Note: Chlorosis has no matching item in the list. Explanation is given below.

Explanation:

Stem tubers are plants which store their food in their stems. Potatoes are stem tubers.

Conditioned reflex is a reflex is acquired gradually by training in association with specific repeated external stimuli. For example, the Russian psychologist Ivan Pavlov's  performed experiments on conditioned reflex using a dog. He demonstrated that a dog will salivate on the sound of a bell even if there is no food given to it if the ringing of the bell preceded every feeding session of the dog.

William Harvey discovered the circulation of blood and the function of the heart .

The islets of Langerhans found in the Pancreas secretes the hormone, insulin.

Autotrophs are organisms which are able to manufacture their own food, Blue green algae are examples of autotrophs.

Active transport is transport which requires expenditure of energy and occurs against the concentration gradient of the substance being transported. Because the concentration of minerals in the soil are in very low concentration, active transport is used by the root hair cells carrier proteins to move mineral ions across the membrane into the cell against the concentration gradient. ATP hydrolysis provides the energy for this process.

Chlorosis is a disease which appears as the yellowing of leaves in plants and in human a green tinging of the skin which is caused by the deficiency of minerals especially iron and manganese.

A
B
C
D
Need help PLEASEE

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

Ur answer is D.

Thanks,

What is an example of a learned behavioral adaptation?
O camouflage
O hunting
O hibernation
O migration

Answers

Answer:

Hunting

Explanation:

Camouflage is a hereditary physical aspect, whereas hibernation and migration are instinctual. Hunting is a learned behavior as it is not as ingrained as the other two and is not automatically done.

P.S. at first I read the answer choices to the tune of "O, christmas tree"

Which of the following improves your range of motion and helps prevent
injuries?
A. A healthy body composition.
B. Strong flexibility,
C. Strong cardio-respiratory endurance.
D. A good sense of balance.
SUBMIT

Answers

Answer:

B. strong flexibility

Explanation:

Being flexible allows your body to move in a fuller range of motion and can help prevent injury because you aren't putting as much strain on yourself.

Heat energy is the transfer of _______ energy. A. chemical B. thermal C. electrical D. mechanical PLS HELP

Answers

Mechanical I think I’m not sure sorry
B, thermal. Chemical would do more with chemicals (surprise) reacting with each other. Electrical has to do with electrons moving. Mechanical would be due to movement (think of how you’d get sweaty after working out).

Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.

Answers

Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.

Explanation:

The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.

In the MOUTH, the following occurs:

--> The food is cut and grinded into smaller pieces by the help of the teeth.

--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.

--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.

At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:

--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.

--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.

--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).

At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.

--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.

--> pancreatic juice contains three important enzymes whose activities include:

• Amylopsin: Breaks down complex sugar to maltose

• Trypsin: breaks down protein into peptides

• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).

--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.

At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:

• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).

• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).

Absorption takes place at the small intestine.

Write a hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant

Answers

Hypothesis:

As the tomato plant grows, nitrogen levels in the soil will decrease

A hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant is As the tomato plant grows, nitrogen levels in the soil will decrease.

What is soil ?

The  soil is  a mixture of different components which comprises  minerals, organic matter, and living organisms, it is a loose sediment,  Moreover, there are different types of soil like Clay Soil, Sandy soil, Loamy Soil, Silt Soil

soil  it is One of the most crucial components of the biosphere, this particle is composed of 45% minerals, 50% spaces  and 5% organic matter, the soil involve in  many important functions such as Providing a growth medium for the plants, Acts a modifier of the earth’s atmosphere

The formation of soil involve in different process , it can be formed   by weathering of rocks and the weathering of Solid rock  occur in three way like Mechanical Weathering, Chemical Weathering, Biological Weathering

For more details regarding soil, visit

brainly.com/question/8937689

#SPJ2

The major goal of the Social Gospel movement in the late 19th and early 20th century was to: Promote the spread of Protestantism in United States territories Promote the spread of Protestantism in United States territories Draw the attention of Protestant churches to the plight of the urban poor Draw the attention of Protestant churches to the plight of the urban poor Encourage support for Charles Darwin's theory of biological evolution Encourage support for Charles Darwin's theory of biological evolution Spread Nativist sentiments

Answers

Answer:

Draw the attention of Protestant churches to the plight of the urban poor.

Explanation:

The main aim and goal of the Social Gospel movement was to bring attention of Protestant churches to the difficult and dangerous solution of the urban poor. The main purpose of this movement is to combat injustice, suffering and poverty in the society. This movement started to solve the social problems such as social injustice, poverty, crime, economic inequality, alcoholism, Racial tensions slums, clean environment and child labor etc. This movement begun in the 20th century and has a great effects on he progressive-minded reformers.

How does factory farming impact workers, specifically undocumented people and people of color?

Answers

Answer:

Driven by rigid contracts set forth by their corporate partners, factory farms knowingly jeopardize workers' health in order to maximize profits. A large percentage of factory farm workers are black and brown peoples including migrant workers from Mexico and other parts of Latin America.

Explanation:

Why are enzymes important for chemical
reactions?

Answers

Answer:

Enzymes greatly increase the reaction rate, or catalyze them.

Explanation:

Without them, many of us would not be alive, because the reactions wouldn't be fast enough!

Which limiting factor is being displayed when a fox chases after a pika

Answers

Here it is a hope it helped you!

T-lymphocytes are created in the bone marrow and then developed in the

spleen.

adenoids.

thymus.

tonsils.

Answers

Answer: I would say it is in thymus.

Answer:

It is thymus, I just did the question and got it right.

Select the conditions caused by fungi.


rust

yellow mosaic

barley yellow dwarf

blight

Stewart’s wilt

holcus spot

stalk rot

Answers

The answers are the following:
-Rust
- yellow mosaic
- blight
-Stalk rot

—Evidence—
•] Rusts are plant diseases caused by pathogenic fungi of the order Pucciniales.

•] Wheat yellow mosaic (usually called wheat spindle streak mosaic) is caused by a soilborne virus which also is transmitted by the soilborne fungus, Polymyxa graminis.

•] Blight spreads by fungal spores that are carried by insects, wind, water and animals from infected plants, and then deposited on soil. The disease requires moisture to progress, so when dew or rain comes in contact with fungal spores in the soil, they reproduce.

•] Fusarium stalk rot, primarily caused by the fungus Fusarium verticilliodes, is a common disease in the Midwest. This fungus also causes Fusarium ear rot and can infect roots, stalks, and leaf nodes. It is most common in hot, dry years.
Other Questions
Can someone answer this 5. Two plumbing companies charge the rates shown in the table. Findhow long the plumbing companies would need to work for Pipeline'scharges to be greater than Down the Drain's.Hourly RateCompanyPipelineFixed Charge for Visit$25.00$32.50Down the Drain$22.50$50.00 Tests, fixes, and maintains network systems: What is a subreport? Please show work if you can so I can fully understand the problem thanks Example customer email: "Hey there, I ordered a beverage from one of your stores, and when I picked it up I was really disappointed. The drink wasn't chilled, and the glass was dirty. The staff there said they are unable to refund it and I need to contact you for a refund. Are you able to help." For this customer, we will provide them a free replacement drink on their rewards account. Please write out a complete email response as if you were writing to this customer directly. (Include Greeting and Closing) Please help. You will get points. Please answer it right. I don't have many points left. A physical change to a substance can never be reversedincrease or decrease the mass of a substancechanges to type of matter the substance is made ofchanges one or more of the physical properties of a substance Write the exact line where the author says that Don Quixotesmind becomes transformed PLEASE HELP!!!What does Roosevelt mean in the final line? Unless these rights have meaning there, they have little meaning anywhere. What would happen within a few months if all decomposers on Earth disappeared overnight?There would be an overabundance of organic waste.Plants would grow out of control.Animals would grow out of control.There would be no visible impact. 3(x - 6) = -15 + 3xYes no solution show work The function Rx) = x2 is graphed above. Which of the graphs below represents the function g(x) = x2 -3? A checking account has a balance of $350 a customer makes Cu with drawls 150 more than the other then he makes a deposit of 75 what is the answer The cost of direct materials transferred into the Bottling Department of the Mountain Springs Water Company is $327,600. The conversion cost for the period in the Bottling Department is $528,000. The total equivalent units for direct materials and conversion are 25,200 and 8,800 liters, respectively. Determine the direct materials and conversion cost per equivalent unit. Round your answers to the nearest cent. $fill in the blank 1 per equivalent unit of materials $fill in the blank 2 per equivalent unit of conversion costs How is natural selection similar to selective breeding? How is natural selection different from selective breeding? What's the definition of the word exaggeration? work out 11. 28- 2.843 Which of the following sentences contains an idiom?The waves jumped onto the rocks and hissed at the spectators.Sheila's mother reminded her to always look for the silver lining.Cal cruised confidently in his new carThe chick was as fluffy as cotton candy. How does the meaning of ethics relate to integrity? Explain in ur own words, give examples.