which of the following is a good research question for a persuasive report

A. How long did dinosaurs live

B.Which was the biggest dinosaur

C. Should scientist clone dinosaurs

D. What was life like to the T.rex ​

Answers

Answer 1
C. Should scientist clone dinosaurs :))
Answer 2

Should scientist clone dinosaurs is a good research question for a persuasive report. Hence, option C is correct.

What is a persuasive report?

Argument essays, another name for persuasive writing, use logic and reason to demonstrate why one idea is more valid than another. It makes an effort to influence the reader to take a specific position or action.

The goal of persuasive literature is to compel the reader to take an action. These books are non-fiction.

To persuade, inspire, or drive readers toward a particular point of view or viewpoint is the goal of persuasive writing. Any attempt to convince implies that there are other valid points of view on the matter. Texts can be written in a variety of ways, such as an advertisement tempting you to buy chocolate, a banner urging people to give up smoking, or a trip brochure luring the reader to travel.

Thus, option C is correct.

For more information about persuasive report, click here:

https://brainly.com/question/29806635

#SPJ2


Related Questions

Who is Mustafizur Rahman ?

Answers

Answer:

Mustafizur Rahman (born 6 September 1995) is a Bangladeshi international cricketer. He is specialized as a left-arm fast-medium bowler. He has taken the most wickets (13) in a debut One Day International (ODI) series. He is the first player to win the ‘Man of the Match’ award on both Test as well as ODI debuts.

Answer:

left-arm fast bowler

Mustafizur Rahman is a left-arm fast bowler and he plays for Bangladesh National Cricket Team. He recently started his International Cricket career but this few times, Mustafizur established himself as a famous Bowler in the world.

Explanation:

Name three predators of the Capybara​

Answers

Explanation:

A constant source of water is important to capybaras, who retreat into murky waters to escape from predators like jaguars, anacondas, caimans, pumas, ocelots, and harpy eagles. Capybaras are physically well-adapted to a semi-aquatic lifestyle.

Answer:

Caimans, ocelots, harpy eagles, and anacondas are the predators of the Capybara, hope it helps

Which term best identifies A Christmas Carol?

a.novella

b.book

c.novel

d.story

Answers

Answer:

A

Explanation:

A Christmas Carol is a Novella because the whole book focuses on different times of his life an experience. when you search the book the first result is from wikipedia under the novella genre.


if this helped feel free to give brainliest and have a great day!

i need a essay on cyberbullying

Answers

Answer:

its like people bully online cause they want say it to your face

Explanation:

What are the four parts
of a paragraph

Answers

The introduction, body, body 2 and than your conclusion. I’m pretty sure

this insect as useful as harmful as well as there . rearrange it

Answers

Answer:

is this a riddle or what im confused edit the question and add more detail then ill answer it for u but im lost sorry :/

What effect does this speech have on George, Sam, and Rameck? They are shocked to hear about the varied quality of care. They are inspired and determined to make a difference. They are confused and eager to make sense of the situation. They are skeptical and quick to question the speaker.

Answers

Answer

what are the answers?

Explanation:

it could be b " they inspired and determined to make a difference" just doing that question

Answer:

it is b

Explanation:

because after they herd him say that they felt that they were ready and determined to change the world and help those in need

Question 2 of 12
Which sentence is worded correctly and avoids using a run-on?

A.
The car had to swerve suddenly when they saw another car going through a red light; thankfully there was no accident.

B.
The car had to swerve suddenly they saw another car going through a red light, thankfully there was no accident.

C.
The car had to swerve suddenly when they saw another car, going through a red light thankfully there was no accident.

D.
The car had to swerve suddenly, when they saw another car going through a red light, thankfully there was no accident.

Answers

Answer: It's A

Explanation: the ; it put at the right spot between sentances. with out it, it would have been a run-on or two consecutive sentances.

Aha!” cried he. "Here is plenty of food for all. No more need to starve." "Hush," said his cousin. "You must not shout here. The place is too wonderful. Sit down quietly and eat.”

Which provides a summary of the selection?

A. One cousin finds a magic stone but refuses to share it with the other.

B. Two cousins disagree about how to use a magic stone and finally sell it.

C. Two cousins disagree on how to feed their families and finally go hungry.

D. One cousin uses a magic stone wisely while the other loses it due to greed.​

Answers

Answer:

A

Explanation:

because the cousin wanted to more food.

Answer:

d

Explanation:

if that is all for that question then it could be d cause later on it said kofi had taken enough for his family while spider had taken it

a doesn't make much sense cause kofi had refused because it said spider was wicked, but still took enough for their family, with b and c it didn't say anything about a disagreement which leaves d

why do anne and peter have different perspectives on their star? what does this tell you about anne? diary of anne frank

Answers

Answer:

Several humanitarian organizations are devoted to her legacy. "Anne was a lively and talented girl, expressing her observations, feelings, self-reflections, fears, hopes and dreams in her diary," said Annemarie Bekker of the Anne Frank House in Amsterdam. "Her words resonate with people all around the world."

"While candy is tasty, it gives me a stomach ache." Is this a simple, compound, or complex sentence?

Answers

Answer: complex sentence

Explanation:

A complex sentence is A simple sentence in grammar has only one main or independent clause and no dependent or subordinate clauses.

The sentence given only has one main clause, so it’s a complex sentence

HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Sorry

Explanation:

Sorry

i would have to say that A would be your answer

To prepare for the test, Andrew takes notes and studied.

Which answer corrects the error in verb tense?

Question 1 options:

To prepare for the test, Andrew took notes and studied.


To prepare for the test, Andrew was taking notes and is studying.


To prepare for the test, Andrew took notes and is studying.


To prepare for the test, Andrew takes notes and will study.

Answers

To prepare for the test, Andrew took notes and studied.

PLEASE HELP ITS DUE TODAY AND I DONT KOW ITS FOR 10PTSS
Making the Most of Mucus
Just the name itself will make you giggle. It's a great word that conjures visions of slime and unpleasantness. It is perhaps the most annoying part of having a cold or allergies. Mucus, however, plays a very important role in defense of our bodies and our health. In fact, it's high time mucus got a lot more respect.

First, there are some amazing facts about mucus that are worthy of respect. Humans produce about a liter of mucus every day, whether they are sick or not. Bony fish and some invertebrates (snails or slugs) also have mucus cells on the outside of their body. This external mucus creates a protective coating that prevents predators' toxins from doing harm. Humans produce mucus to protect our stomachs, our lungs, and several other systems.

We tend to not like mucus because it is a considered a symptom or sign that something is wrong. We usually only see it when we are sick, and so we tend to dislike it. According to Michael M. Johns, III, MD, however, "mucus is incredibly important for our bodies." Johns, an assistant professor at Emory University, calls mucus "the oil in the engine" of our bodies. Without mucus, our engines, or bodies, would freeze up and stop working properly.

Furthermore, mucus is not just the nasty gunk you see when you are sick. It lines the tissues in your mouth, your nose, throat, and lungs. It also is crucial in protecting your digestive system. Mucus puts a protective coating over the surfaces of these tissues, keeping them moist. Most of the time we don't notice mucus is making our lives better. It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Occasionally, though our mucus-making membranes go into overdrive. If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you. If you come into contact with pollen, you may get a runny nose and start sneezing and coughing. When these things happen, your mucus systems start making more fluids to wash away the irritating particles. Mucus also has some antibodies that increase our ability to fight off bacteria and viruses.

It's hard to appreciate what is essentially slime, but we have mucus for some very good reasons. It helps to keep us healthy and lets us know when our bodies are under attack. We would be wise to respect what our bodies do to keep us safe. So the next time you find yourself reaching for a tissue, remember mucus is your friend and ally.

Which line from the text explains people's attitude about mucus? (1 point)

a
If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you.
b
Humans produce mucus to protect our stomachs, our lungs, and several other systems.
c
We tend to not like mucus because it is a considered a symptom or sign that something is wrong.
d
It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Answers

Answer:

C

Explanation:

It's the only choice that actually expresses an opinion.  Plus, it says it directly in the text.

Hope this helps :)

The answer to this question is d I believe hope you get it right and good luck

what does katniss call the tributes from the wealthier districts and why?

(also what page the answer was found in) ​

Answers

Answer:

As Katniss explains, the Career Tributes are those tributes from the wealthier districts (typically Districts 1, 2, and 4) who have trained their whole lives to take part in the Hunger Games. ... As a result, they are generally better prepared for the challenges of the Hunger Games and are typically the winners.

Please answer as soon as possible,thanks.

Answers

Answer:

I WOULD SAY ITS B

Explanation:

If you were shorter than someone, would it be possible to talk down to them?​

Answers

Answer:

yes

Explanation:

stand on a ladder

Answer:

yes

Explanation:

1) How does Citra's thoughts on not being
Scythe material create irony in the text?

Answers

aye man ion em knoExplanation:

how can we say that junk food has become a global culture.​

Answers

Answer:

Junk food has become a global culture because it is convenient and you can basically eat it anywhere.

Explanation:

In this modern day and age, people are always busy, no matter what your job/work is. Because of this work environment, maintaining health is not a priority. Just thinking about eating and munching down food is enough for an average person without looking out for the health components of the food. At the end of the day, we want something sweet, something we crave. Health is not a huge motivator in that time frame. Junk food has also been very convenient when it comes to emotional fulfillment. You can just much on it while wallowing in all of your problems and quite frankly, it can be a great companion. Not for your bodily systems though.

What is the purpose of the Bill of Rights?

to limit the rights of individual citizens
to limit the rights of individual citizens

to inspire the governments of other nations
to inspire the governments of other nations

to guarantee freedoms that belong to every citizen
to guarantee freedoms that belong to every citizen

to explain the procedure for amending the Constitution

Answers

Answer:

C). to guarantee freedoms that belong to every citizen

Explanation:

'The Bill of Rights' is a federal document that was primarily designed to grant basic civil rights as well as liberties to each and every citizen of the United States. It is the first out of ten amendments of the United States' Constitution that 'guarantees the freedom of speech, liberty, religion, press, petition, and assembly to its citizens.' Thus, it explains the types of freedom granted to the citizens of the United States as per their constitution. Hence, option C is the correct answer.

Compare and contrast the characters of Rowan and Citra up to this point in the book. How do their character traits make either of them a better fit for being a scythe?

Answers

Answer:

The most notable difference that I remember between Rowan and Citra is that Rowan seemed more absolutely determined, while Citra seemed to carry some determination, albeit with compassion more prominent.  This brings into question the idea of worthiness for being a Scythe - since a Scythe is able to kill people at a whim with no repercussions, perhaps even with praise, should one value compassion or absolute unbiased determination?  Objectively, Rowan is better fit - he is more determined and able to take lives due to his nature.  This will be seen later on in the book if you read what happens to him in the future.  However, as compassion is needed when interacting with others, especially given a difficult idea such as killing, Citra may be a better fit, as she can be empathetic to those who are in the position of being gleaned.

TL;DR: It depends on your point of view.  Both are good candidates, as Faraday asserts simply by choosing them to be his apprentices.

What is composition?

answer: B. How the objects in a photograph are positioned

A. The way in which light is used in an image or video

B. How the objects in the photograph are positioned

C. A small, compressed file that contains visual data

D. A tool used for trimming parts of a video or image​

Answers

B. How the objects in the photograph are positioned

What are two characteristics of expository text?

Answers

Answer:Informative. Expository text is meant to deposit information.

Clarity. Using words that clearly show what the author is talking about.

Explanation:

At Cindy's birthday each guest will get one-third of a medium sized pizza. There
will be 12 people at the party, including Cindy. How many pizza's does her mom
need?

Answers

Answer:

36

Explanation:

12 divided by 1/3= 36

Social media have the ability to spark revolutions, such as the one in Egypt in 2011, because social media:


A. allow many people to organize quickly.

B. were created to spark revolutions and protests.

C. are provided by antigovernment organizations.

D. often censor antigovernment posts or emails.​

Answers

Answer:A

Explanation:

Please which one is the right answer

Answers

Answer:

a

Explanation:

maby

Answer:

The last one is the answer so you are correct.

Explanation:

3. Which technique increases the emotional impact of rhetoric?
symbolism
irony
connotative language
denotative language

Answers

Answer:

Connotative Language

Explanation:

I just took the test, enjoy

extrinsic motivation is

Answers

Answer:

Extrinsic motivation is reward-driven behavior. It's a type of operant conditioning. ... In extrinsic motivation, rewards or other incentives — like praise, fame, or money — are used as motivation for specific activities. Unlike intrinsic motivation, external factors drive this form of motivation.

Explanation: :)

Answer:

i think its motivation that comes from the outside

Explanation:

edge 2021

After leaving Stratford, and moving to London, what profession did Shakespeare hold?

Answers

Answer: His theatre work was in London but he was often with his family in Stratford, where he also attended to his business interests. He accumulated a property portfolio in both places while participating in the management of several theatres and acting companies in London.

Hope this helps.

Explanation:

9. Lady Macbeth greets Duncan
A. with undisguised jealousy and ambition
B. and advises him on affairs of his kingdom
C. as a perfect hostess would greet a guest
D.with news of Macbeth's failure to arrive

Answers

C. As a perfect hostess would great a guest
Other Questions
In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me