Which of the following did not cause factory workers to organize and create Labor Unions, which fought for workers rights?
A. Unfair pay
B. long work hours
C. Just and fair employers
D. Unsafe working conditions

Answers

Answer 1
.............................The answer is C

Related Questions

What was the purpose of the trip?

Answers

Purpose of trip

The purpose of a trip—for example, traveling to work or visiting friends—greatly influences travel behavior and mode choice. For example, a person's trip home from work is recorded as a work trip—again, even if the person ran several errands as well on the trip.

Please helppppppppppppppppppppp

Answers

Answer:

salt and gold is ur answer

Answer: Gold and Salt

Explanation:

Salt and good were their main goods.

The United States’ policy of containment after World War II was intended to prevent communism from spreading beyond
the Middle East.
South America.
the Soviet Union.
Western Europe.

Answers

The United States’ policy of containment after World War II was intended to prevent communism from spreading beyond the Soviet Union.

What was the US's containment policy?

The policy of containment was focused on the prevention of expanding communism after the end of WWII. It was achieved by making the nations capable enough and prosperous on their own to eliminate dependency on communism.

Therefore, the US helped the European nations with economic and military aid as the Soviet Union was influenced by communist practices.

Learn more about the US policy here:

https://brainly.com/questiaon/1028570

The United States' policy of containment after World War II was intended to prevent communism from spreading beyond the Soviet Union, specifically targeting its influence in Eastern Europe and other regions. Therefore, option C is correct.

The United States' policy of containment, developed in the aftermath of World War II, aimed to prevent the spread of communism and Soviet influence. It formed the basis of U.S. foreign policy during the Cold War era.

The strategy involved containing and limiting the expansion of communism through various means, including military alliances (such as NATO), economic aid (such as the Marshall Plan), and diplomatic efforts.

The policy of containment was driven by the belief that if communism was allowed to spread unchecked, it would threaten the security and interests of the United States and its democratic allies.

Learn more about United States' policy of containment here:

https://brainly.com/question/1134095

#SPJ6

Please help me!! :)

Answers

Answer:

1= 4th

2= 3rd

3= 1st

4= 5th

5= 1st

Explanation:

I Took The Quiz And Got This Correct.

Capitalism definition in your own words PLEASE

Answers

Answer:

Capitalism is an economic system in which private individuals or businesses own capital goods

Explanation:

The production of goods and services is based on supply and demand in the general market—known as a market economy—rather than through central planning—known as a planned economy or command economy.

Capitalism, also called free market economy or free enterprise economy, economic system, dominant in the Western world since the breakup of feudalism, in which most means of production are privately owned and production is guided and income distributed largely through the operation of markets.

Question- what was their main economic activity.

I need help read and answer the question plz

Answers

Answer:

trade

Explanation:

sold and bought items

what was the policy of brinksmanship

Answers

Answer:

The policy of brinksmanship is a policy of willingness to go to the edge of war in order to make an opponent concede.

Explanation:

When two or more countries are in conflict with one another, they often use their military's prowess as a threat to make the opposition lost their interest.

This strategy used to create a tension within the opposition based and make them think that engaging in war with the opposition actually will cost more than the value that they get from their initial interest.

Example of this would be what United States and the Soviet Union did during the civil war.  In order to fight for influence over several regions across the war, both countries continuously established military's bases that's close with one another.

Please help me I don’t know this

Answers

Answer:

2: we the people

Explanation

the words we the people mean rule by the people

The last extermination camp was

Answers


Stutthof concentration camp

It was also the last camp liberated by the Allies on 9 May 1945. It is estimated that between 63,000 and 65,000 prisoners of Stutthof concentration camp and its subcamps died as a result of murder, starvation, epidemics, extreme labour conditions, brutal and forced evacuations, and a lack of medical attention.

How did America's stance on WWI change over the course of the war?

Answers

Answer:

Despite sympathies with Great Britain, France and their allies, the United States stayed neutral in the first years of the war. ... When the United States entered the war in April 1917, the U.S. Army had only 130,000 troops, no tanks and few planes. Congress quickly approved conscription to strengthen the forces.

Explanation:

Answer:

America had a stance of neutrality in 1914.  But in 1915 a movement declared that the U.S needed a much stronger army and the best way to achieve it would be entering WW1. In 1917, Germany sensed the tide was turning. German leaders agreed in January of 1917 to resume unrestricted submarine warfare to break the devastating army stalemate in Europe and the British navy’s successful blockade of critical German supply ports. This pushed American public opinion toward intervention. Germany’s unrestricted submarine warfare sent more ships to the ocean’s floor and the loss of American lives spiked. The U.S. protested and in February 1917 severed diplomatic relations with Germany, while Congress approved funds for increased military affairs. On April 2, President Wilson asked Congress to declare war against Germany specifically citing Germany’s renewed submarine policy as “a war against mankind. It is a war against all nations.” He also spoke about German spying inside the U.S. and the treachery of the Zimmermann Telegram.

On April 4, 1917, The United States went to war.

Explanation:

How were Free People of Color treated in Louisiana's constitution of 1812?​

Answers

Answer:

Just before the civil war, they were enslaved around 1860 or so. They were treated as second class citizens and given no representation therefore. They were allowed to vote around 1965. So I think its D.

How did Jan Matzeliger change the shoemaking industry in the 1800s?

Answers

Answer:

stitching shoes was laborious, so matzeliger invented the sewing machine.

:)

Explanation:

hey um i need help with this project its about the 3 kingdoms of egypt​

Answers

Answer:

The history of ancient Egypt is divided into three main periods: the Old Kingdom (about 2,700-2,200 B.C.E.), the Middle Kingdom (2,050-1,800 B.C.E.), and the New Kingdom (about 1,550-1,100 B.C.E.). The New Kingdom was followed by a period called the Late New Kingdom, which lasted to about 343 B.C.E.     PLS THANK ME AND VOTE ME AND BRAINLIEST ME

Explanation:

What is the olest phone ever

Answers

Answer:

A flip phone

Explanation:

Answer:

the oldest phone doesn't really have a name but the oldest mobile phone ever is called the 1989 – MOTOROLA MICROTAC 9800X

Which of the following had the best relationship with the Indians?

France


England


Spain

Answers

Answer:

Spain .         brainliest?

Explanation:

Spanish leaders formed alliances with some of the Indian tribes and provided them with tools, crops, livestock, and arms. The new materials available to these tribes gave them superior weaponry over their enemies. As Indians acquired horses, they became more mobile.

I think it was France. Hope it helps:)

Can someone please help me with this I’ll give them extra points and brilliant it actually has to be an answer though

Answers

Answer:

im pretty sure its main idea

Explanation:

Answer:

Main idea

Explanation:

Why hadn't conquistadors conquered Africa during the age of exploration?

Answers

Answer:

Because they didnt have drugs to fight malaria

Explanation:

Malaria was a big deal and very big in Africa too.

Please Help
When Britain agreed to let the 49th parallel be US/British boundary, what other state boundary was being debated with Britain?
a.
Maine
c.
California
b.
New Mexico
d.
Alaska

Answers

Maine. Maine is near the northeast corner of the US and borders Canada.

Answer:

Mainnnnnnne weeeeeeeeeeeeeeeeeeeeeeeeeeee

Explanation:

what was governmental policy toward strikes during the gilded age?

Answers

Answer:

Explanation:The Gilded Age” is the term used to describe the tumultuous years between the Civil ... During this era, America became more prosperous and saw unprecedented ... workers and ignoring standard business rules—and in many cases, the law itself. ... At its peak, over 100,000 railroad workers were on strike.

PLS THANK ME AND BRAINLIEST ME

The more successfully the government convinces both employers and unions that it will no longer submit to economic coercion, the less is the likelihood of strikes against the government. The policy which the government adopts toward prices will determine the policy which it pursues toward the adjustment of wages.

HELP ITS DUE TODAY AND IM LAZY

Answers

Answer:

inca in peru

Explanation:

bro

There is a famous quote: “It would take the wisdom of Solomon to solve this problem” What does this quote refer to? Please help!

Answers

I think Solomon was a really smart person i forget what he did though people called him wise.

ILL GIVE BRAINLY THING

The Seven Years War was a war between


France and Native Americans


Spain and Britain


France and Spain


France and Britain

Answers

the war was france and britain

franch and britian

Explanation:

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
questions.
Online Content: Site 1


Robert Bunting did not want to join the war effort initially. What event changed his mind?

Answers

Answer:

b

you wecome f

Explanation:

Answer:

Direct democracy can be seen as a kind of system where citizens directly discuss and vote on the main issues of interest. This kind of democracy arose in Ancient Greece, where popular assemblies assembled the population of democratic city-states in the Agora (square), where laws and key decisions were discussed and resolved. Remember that in the Greek way, the exercise of political opinion was restricted to a specific portion of the population.

Explanation:

Hurry!!

Francis Marion, also know as the Swamp Fox, used guerrilla
warfare while fighting the British in the South. Was Francis
Marion successful in using these techniques with his troops?
Explain why or why not.

Answers

Answer:

use ur brain and pay attention in class

Explanation:

Answer:

yes because he was able to maneuver through the swamps and avoid and distract British forces and win battles through stealth and other resourceful tactics

Explanation:

Did Industrialization lead to progressive changes for everyone who lived in the United Kingdom during the 19th Century?

Answers

i just had my phone number and lord lord president president and president president of president president lord president president and

Why might this question trouble the nation for centuries

Answers

Answer:

ggggggggggg

Explanation:

Someone please help ASAP ill give Brainliest

Answers

Answer:

the answer will be 2 Jose Antonio's

Jose Antonio Navarro

why does the term "propaganda" carry a negative connotation

Answers

Answer:

The word “propaganda” has a negative connotation – that is, people tend to use it for practices that they disagree with. It’s typically used to describe things like Communist propaganda or Fascist propaganda. These phrases imply that there’s something dishonest and sinister about propaganda.

Explanation:

THAT was copied and pasted from g0ogle so please re-word it

Specifically, I’m talking about a word to describe the sum of all messages a particular political member has broadcast (through various media), but one without the negative connotation of “brainwashing” that propaganda can carry.

the total value of goods and services produced in an economy per year is measured by the:
a. unemployment rate
b. gross domestic product
c. consumer price index
d. rate of inflation

Answers

GROSS D Ø M E S T I C PRODUCT

The total value of goods and services produced in an economy per year is measured by the gross domestic product (GDP). Hence option B is correct .

What is  total value of goods and services produced in an economy per year is measured ?

GDP is a macroeconomic indicator that reflects the monetary value of all final goods and services produced within a country's borders in a given period, typically a year.

GDP is calculated by summing up the value of all goods and services produced by individuals, businesses, and the government, including consumption, investment, and government spending, and net exports (exports minus imports). GDP is often used as an important indicator of a country's economic growth and development.

There are three methods for calculating GDP: the expenditure approach, the income approach, and the production approach. The expenditure approach sums up the total spending on goods and services in the economy, the income approach sums up the total income earned by individuals and businesses, and the production approach adds up the total value of goods and services produced by each industry or sector in the economy.

GDP is a crucial measure of economic activity, and changes in GDP can have significant impacts on a country's economy and its citizens' lives, including employment, income, and quality of life.

Learn more about gross domestic product here

https://brainly.com/question/11641137

#SPJ7

NEED HELP ASAP PLEASE PLEASE ❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️

Which phrase best completes
this list?
Themes of Transcendentalism
Oneness with nature
Goodness of humans
?
A. Duty to country
B. Logic and reason
C. Individualism
D. Formal religion

Answers

Answer:

C.

Explanation:

Answer: Individualism

Explanation:

Other Questions
what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? Convert the fraction 7/8 into a decimal number A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 need helps pls will give thanks Jori is 2 years older than Sage but 4 years younger than Victoria. Sage is 3 years less than a score. How old is sage? please show an explanation. How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) Change the following sentence into passive form1. What question did they raise in the discussion?2. They are going to build that bridge in 20183. They used to build houses of wood 4. How many trees can we save for every ton of recycled newsprint ?5. We can make many things from wood 6. If I were you. I wouldnt accept his invitation 7. They must do it before I come 8. Where do they keep a large collection of books?9. They can find the books they want in the library 10. What do they keep a large collection of the books for ?Thank you very much What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC