Which of the following determines and objects ability to float in water

Atomic number

Mass and volume

Displacement in a liquid

Mass and gravity

Answers

Answer 1
I think its
Mass and volume

Related Questions

Which of the following would be considered an exercise program?

a
basketball
b
football
c
aqua dynamics

d
soccer

Answers

probably c

.........

Answer:

c

Explanation:

Solve for v
when
d = 10 and
t=5

Answers

Answer:

asfsdfasasfsda

Explanation:

Answer:

IDEK HOW TO SOLVE

Explanation:

The shortstop plays between first and second base.
true or false

Answers

SINGLE TO RIGHT OR CENTER FIELD-On a single to center or right field the first baseman will be the cutoff to home. The shortstop will cover second base.

The model shows how solar-powered electric cars indirectly use energy from the Sun. Describe the energy transformations that you see.

Answers

Answer:

Radiant energy from the Sun is converted into electrical energy. Electrical energy is then converted into chemical energy. Chemical energy is then converted into electric energy for the motor. The motor converts electrical energy into mechanical energy and makes the car move.

Sun makes radiant energy > converted to electrical energy through solar panels > converted to chemical energy which is then stored in a battery for the motor > converted into mechanical energy to make the car move

Extra:

Look at the image below for a better understanding of the question. I hope this helps! :)

Source:

Edmentum Guided Notes

The energy transformations that can be seen in solar-powered electric cars :

Solar energy >  electrical energy > chemical energy  > mechanical energy.

What is  solar-powered electric cars?

A solar electric car is one that is primarily or entirely powered by solar energy. Solar panels typically feature photovoltaic (PV) cells that convert solar energy directly into electric energy. The phrase "solar vehicle" typically implies that all or some of a vehicle's propulsion is powered by solar energy. Communications, controls, and other auxiliary operations might all be powered by solar energy.

In solar electric car, solar energy converted into electrical energy by  photovoltaic (PV) cells. This energy is stored in battery in the form of chemical energy. When the car moves, this chemical energy transforms into mechanical energy.

Learn more about solar-powered car  here:

https://brainly.com/question/8879544

#SPJ2

What type of system is a black hole? Explain how you know.

Answers

Answer:

A black hole is a region of spacetime where gravity is so strong that nothing—no particles or even electromagnetic radiation such as light—can escape from it.[1] The theory of general relativity predicts that a sufficiently compact mass can deform spacetime to form a black hole.[2][3]

The boundary of the region from which no escape is possible is called the event horizon. Although the event horizon has an enormous effect on the fate and circumstances of an object crossing it, according to general relativity it has no locally detectable features.[4] In many ways, a black hole acts like an ideal black body, as it reflects no light.[5][6] Moreover, quantum field theory in curved spacetime predicts that event horizons emit Hawking radiation, with the same spectrum as a black body of a temperature inversely proportional to its mass. This temperature is on the order of billionths of a kelvin for black holes of stellar mass, making it essentially impossible to observe directly.

Objects whose gravitational fields are too strong for light to escape were first considered in the 18th century by John Michell and Pierre-Simon Laplace.[7] The first modern solution of general relativity that would characterize a black hole was found by Karl Schwarzschild in 1916, although its interpretation as a region of space from which nothing can escape was first published by David Finkelstein in 1958. Black holes were long considered a mathematical curiosity; it was not until the 1960s that theoretical work showed they were a generic prediction of general relativity. The discovery of neutron stars by Jocelyn Bell Burnell in 1967 sparked interest in gravitationally collapsed compact objects as a possible astrophysical reality.

Black holes of stellar mass are expected to form when very massive stars collapse at the end of their life cycle. After a black hole has formed, it can continue to grow by absorbing mass from its surroundings. By absorbing other stars and merging with other black holes, supermassive black holes of millions of solar masses (M☉) may form. There is consensus that supermassive black holes exist in the centers of most galaxies.

The presence of a black hole can be inferred through its interaction with other matter and with electromagnetic radiation such as visible light. Matter that falls onto a black hole can form an external accretion disk heated by friction, forming quasars, some of the brightest objects in the universe. Stars passing too close to a supermassive black hole can be shred into streamers that shine very brightly before being "swallowed."[8] If there are other stars orbiting a black hole, their orbits can be used to determine the black hole's mass and location. Such observations can be used to exclude possible alternatives such as neutron stars. In this way, astronomers have identified numerous stellar black hole candidates in binary systems, and established that the radio source known as Sagittarius A*, at the core of the Milky Way galaxy, contains a supermassive black hole of about 4.3 million solar masses.

On 11 February 2016, the LIGO Scientific Collaboration and the Virgo collaboration announced the first direct detection of gravitational waves, which also represented the first observation of a black hole merger.[9] As of December 2018, eleven gravitational wave events have been observed that originated from ten merging black holes (along with one binary neutron star merger).[10][11] On 10 April 2019, the first direct image of a black hole and its vicinity was published, following observations made by the Event Horizon Telescope in 2017 of the supermassive black hole in Messier 87's galactic centre.[12][13][14]

Blackness of space with black marked as center of donut of orange and red gases

The supermassive black hole at the core of supergiant elliptical galaxy Messier 87, with a mass about 7 billion times that of the Sun,[15] as depicted in the first false-colour image in radio waves released by the Event Horizon Telescope (10 April 2019).[16][12][17][18] Visible are the crescent-shaped emission ring and central shadow,[19] which are gravitationally magnified views of the black hole's photon ring and the photon capture zone of its event horizon. The crescent shape arises from the black hole's rotation and relativistic beaming; the shadow is about 2.6 times the diameter of the event horizon.[12]

Schwarzschild black hole

Simulation of gravitational lensing by a black hole, which distorts the image of a galaxy in the background

Gas cloud being ripped apart by black hole at the centre of the Milky Way (observations from 2006, 2010 and 2013 are shown in blue, green and red, respectively).[20]

help plz will give brainliest and dont answer if u dont know

Answers

i think most likely the answer is the first one. meeting other students. if not then maybe the second one, highly motivated.

Answer:

is highly motivated

Explanation:

2 Which of the following effectively summarizes paragraph 2?
A The orientation in space, relative to the Sun, is the cause
of Earth's seasonal changes.
1
B There is an imaginary pole running through the center of
Earth from the North Pole to the South Pole, which is called
an axis.
C We also learned that Earth's axis is tilted 23.5
degrees from the perpendicular of the plane of the
ecliptic.
D The northern hemisphere has more daylight hours.

Answers

Answer:B

Explanation:

The statement that summarizes the paragraph is northern hemisphere has more daylight hours.

What is Earth?

The Earth is part of the nine planet and it comprises of the equator, northern and southern hemisphere.

It is the most suitable place for living because it have water,oxygen and other gases that support life.

Therefore, The statement that summarizes the paragraph is northern hemisphere has more daylight hours.

Learn more about Earth below.

https://brainly.com/question/746553

#SPJ2

What is the momentum of a two-particle system composed of a 1400 kg car moving east at 70 m/s and a second 1300 kg car moving west at 85 m/s? Let east be the positive direction and answer to 3 significant figures.

Answers

Answer:

209000 kg*m/s

Explanation:

Momentum is caclucated using the equation P=mv. Where m is mass and v is velocity.

If you are required to show your work it would be the following:

1400*70=98000 kg*m/s

1300*85=110500 kg*m/s

98000+110500=208500 kg*m/s

209000 kg*m/s

a ball is thrown vertically upwards from the ground. The ball rises and falls back to the ground. Describe the changes in the mechanical energy of the ball as it rises.

Answers

Answer:

as the ball is thrown, the enegry rises up, when it falls, the ball relseases all energy

Explanation:

a catcher "gives" with the ball when he catches a 0.196 kg baseball moving at 31 m/s. if he moves his glove a distance of 5.32 cm, what is the average force acting on his hand?

Answers

Answer:

3540.5N

Explanation:

Step one:

given data

mass m= 0.196kg

speed  v= 31m/s

distance r= 5.32cm = 0.0532m

Step two

The expression relating force, mass, velocity and distance is

F= mv^2/r

substitute we have

F=0.196*31^2/0.0532

F=0.196*961/0.0532

F=188.356/0.0532

F=3540.5N

A 120 Ω resistor, a 60 Ω resistor, and a 40 Ω resistor are connected in parallel and placed across a potential difference of 12.0 V. What is the equivalent resistance of the parallel circuit?

Answers

Answer:

The equivalent resistance of the parallel circuit would be 20 Ω

Explanation:

To calculate the resistance of resistors connected in parallel, the formula to be used is

1/R = 1/R₁ + R₂ + R₃ + R₄...

1/R = 1/120 + 1/60 + 1/40

1/R = (1 + 2 + 3)/120

1/R = 6/120

1/R = 1/20 Ω

This can be rewritten or cross-multiplied to be

R × 1 = 20 × 1

R = 20 Ω

The equivalent resistance (R) would then be 20 Ω

What is radioactive dating? How is it used to determine age of something?
answer 2 question basically please Help!!!

Answers

Answer:

Technique of comparing abundance ratio between radioactive isotopes to a reference isotope to determine the age of a material called radioactive dating. It determines the age by having a more abundance of isotopes in the cellular being.

n which order did the events forming our solar system occur?

The solar nebula became hot and dense pulling in more gas.This flattened into a rotating disk. It spun faster and faster, forming the Sun.
Gas was pulled toward the center, forming the Sun. Gas flattened into a rotating disk and became hot and dense, forming a solar nebula that spun faster and faster.
Gas flattened into a rotating disk and became hot and dense, forming a solar nebula that spun faster and faster. Gas was pulled toward the center, forming the Sun.
The solar nebula spun faster and faster and flattened into a rotating disk. Most of the gas was pulled toward the center, where it became hot and dense, forming the Sun.

Answers

Answer:

The solar nebula became hot and dense because of that it pulling in more gas. This flattened into a rotating disk. It  spun  faster and faster, forming the Sun.

Explanation:

hope this helps

The solar nebula became hot and dense because of that it pulling in more gas. This flattened into a rotating disk. It  spun  faster and faster, forming the Sun. This order did the events forming our solar system occur.

What is Solar nebula ?

In the so-called nebular hypothesis of the genesis of the solar system, the Sun and planets originated by condensation from a gaseous cloud. In 1734, Swedish philosopher Emanuel Swedenborg claimed that the planets arose from a nebular crust that enveloped the Sun before breaking apart. Immanuel Kant, a German philosopher, proposed in 1755 that the Sun and planets were created by a slow rotating nebula that was eventually pushed together by its own gravitational force and flattened into a spinning disc. In 1796, the French astronomer and mathematician Pierre-Simon Laplace presented a similar concept, but with the planets forming before the Sun. The Kant-Laplace theories were criticised by the British physicist James Clerk in the late nineteenth century.

To know more about solar Nebula :

https://brainly.com/question/28715616

#SPJ5.

please help me answer these

Answers

the picture is too foggy re upload it

What is the electric potential at a distance of 1.2 m from a 7.5 UC point charge?
5.6 x 104 v
8.1 x 104 V
5.6 % 1010 V
8.1 x 1010 V

Answers

Answer:

5.6x10^4

Explanation:

use the equation V=kq/d

k is the constant 8.99x10^9

V=(8.99x10^9)q/d

q is the charge, 7.5 micro coulombs, but to get coulombs, multiply by 10^-6

V=(8.99x10^9)(7.5x10^-6)/d

And from the problem, we know that the distance is 1.2 meters

V=(8.99x10^9)(7.5x10^-6)/1.2

This simplifies to 5.6x10^4

The electric potential is 5.6 x 10⁴ v.

To find the electric potential the distance = 1.2 m

Charge q = 7.5 UC

What is electric potential and find the value?

               The amount of work needed to move a unit charge from the known point to some unknown point against the electric field  is said to be electric potential.

Formula of an electric potential is

                                     V = k ( q/r)  volt

                   V - electric potential

                    k - Coulomb constant (8.99x10^9)  

                    q -  charge

                     r- distance of separation

  V = (8.99x10⁹) (q/d)

  q = 7.5 UC ( micro coulomb) 10⁻⁶ C

   V=(8.99x10⁹)(7.5x10⁻⁶)/d

Substituting the values,

    V=(8.99x10⁹)(7.5x10⁻⁶)/1.2

    V = 5.6x10⁴ v

Thus, option A is correct.

Learn more about the electric potential,

https://brainly.com/question/15172925

#SPJ2

Which of the following statements about infrared telescopes is NOT true?
a. They are typically operated at lower temperatures.
b. They are especially helpful for viewing cool or obscured astronomical objects.
c. They were first built in the 1960s.
d. They are often placed on mountaintops.
e. They do not work well at high altitudes.

Answers

Answer:

a. They are typically operated at lower temperatures.

a. They are typically operated at lower temperatures.b. They are especially helpful for viewing cool or obscured astronomical objects.

how would a position-time function look like for linearly increasing negative velocity regions?

Answers

Answer:

Hmmm

Explanation:

Here what I know... If a function gives the position of something as a function of time, the first derivative gives its velocity, and the second derivative gives its acceleration. So, you differentiate position to get velocity, and you differentiate velocity to get acceleration. where t is in seconds and H(t) is in inches.

Does this help?

What are the types of motion that can be observed in a pendulum ? Some one please answer.√

Answers

Answer:

periodic motion

Explanation:

The massive object is affectionately referred to as the pendulum bob. When the bob is displaced from equilibrium and then released, it begins its back and forth vibration about its fixed equilibrium position. The motion is regular and repeating, an example of periodic motion.

Which type of wave has the longest wavelength?

Gamma rays


Ultraviolet rays


Visible light


Microwaves


Radio waves

Answers

Answer:

Radio Waves

Explanation:

Which formula is used to calculate the mass of an object if the force and acceleration are known?

Answers

Answer:

m=F/a so the second one

force÷ by acceleration

How will recreation be affected by sea level rise?

Answers

Answer:

Scientists predict that sea levels could rise up to six-feet by 2100. An increase this large will swallow beaches—impacting public access, beach recreation, and healthy ecosystems. ... With less sand beach-goers will have a completely different recreational experience in the future.

Explanation:

Select the correct answer.
Which diagram represents an object in equilibrium?
ОА.
applied
force = 20 N
force due to
friction = 15 N
OB.
applied
force = 20 N
force due to
friction = 20 N
OC.
applied
force = 15 N
force due to
friction = 25 N
OD.
applied
force = 30 N
force due to
friction = 20 N
ОЕ.
applied
force = 30 N
force due to
friction = 15 N
Reset
Next
My

Answers

Answer:

B

Explanation:

The force and friction cancel each other.

20N - 20N = 0N acting on the object.

Most metals have...

a. Atoms that are spread out, and low specific heats

b. Atoms that are close, and low specific heats

c. Atoms that are spread out, and high specific heats

d. Atoms that are close, and high specific heats

Answers

I think it’s B I THINK

Visible light is the _______ that our eyes can see.

Answers

Answer:

Spectrum because it could respond to a specific color based upon how you humans typically perceive Lights of the wavelength

Answer:

spectrum

Explanation:

A tractor trailer truck traveling at a speed of 105 feet/second skids to a stop in 12 seconds. Determine the skidding distance of the truck.
Please help.​

Answers

Answer:

1260ft

Explanation:

Given parameters:

Speed  = 105ft/s

Time  = 12s

Unknown:

Skidding distance of the truck  = ?

Solution:

To solve this problem:

       Distance  = speed x time

Now insert the parameters and solve;

  Distance  = 105 x 12  = 1260ft

Calculate the Net force from the above Freebody diagram and data table.

Answers

answer 4

Explanation:

An apple in a tree has a mass of 0.21 kg. If it is 7.2 meters above the ground, how much potential energy does it have?

Answers

Answer:

14.8J

Explanation:

PE=MGH

M=0.21

G=9.8m/s

H= 7.2 m

0.21x7.2x9.8= 14.8176 J

State the lows of reflection

Answers

Answer:

The law of reflection states that when a ray of light reflects off a surface, the angle of incidence is equal to the angle of reflection.

Explanation:

Answer: The law of reflection states that when a ray of light reflects off a surface, the angle of incidence is equal to the angle of reflection.

When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2

Answers

Answer:

The velocity of the cricket ball is 17.32 m/s

Time is taken by the ball to reach the highest point = 0.8660 seconds

Explanation:

The cricket ball can be seen and treated as a projectile in this case

The maximum height attained by a projectile in motion can be calculated using the formula:

[tex]h = \frac{v^2 sin^2 \theta }{2g}[/tex]

In any projectile problem, once we know see that the object was released vertically upwards, we need to know that this means that the angle of projection is 90 degrees, and sin 90 is = 1

hence, h will be modified to become

[tex]h = \frac{v^2 }{2g}[/tex]

[tex]v = \sqrt{2gh}[/tex]

We are given that h = 15m and g = 10m/s2

[tex]v = \sqrt{2 \times 10 \times 15} = 17.32m/s[/tex]

The velocity of the cricket ball is 17.32 m/s

B. We can get the time it took to reach the highest point by dividing

time = distance/speed

Time = 15/17.32 = 0.8660 seconds

help!! what are the blanks???

Answers

The earth receives energy from the sun in one day than all the energy consumed by humans in one year.

Amount of energy received from the sun

The sun provides around 174 petawatts of energy to Earth, of which 89 petawatts is absorbed by the planet.

The Global energy consumption is roughly 15 terawatts annually.

Thus, we can conclude that, the earth receives energy from the sun in one day than all the energy consumed by humans in one year.

Learn more about energy of sun here: https://brainly.com/question/2193109

#SPJ1

Other Questions
A little girl is looking to select one crayon and one coloring book to do some drawing. She has 6 different colored crayons and 3 coloring books. How many different combinations of crayons and coloring books can she make if she selects one crayon and one coloring book to use? The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: