Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

Answer 1

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer 2

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH


Related Questions

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

If an egg cell contains 4 chromosomes, how many chromosomes would a sperm cell of the same
species contain?
a. 4, b.8, c.16

Answers

8 chromosomes. In reality each egg and sperm have 23 chromosomes each in order for produce a healthy zygote

Viruses can be prevented by receiving a weakened form of the virus called a?

A)plastid
B)vaccine
C)antibiotic
D)fertilizer

Answers

vaccine, the answer is B

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.

Answers

Answer:

C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.

Explanation:

Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.

Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.

Thus, the correct answer is option C.


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer: here ya go

Explanation: The lytic cycle is one of the two cycles of viral reproduction

Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.

Explanation:

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

what are cotyledons? & what is its use

Answers

Answer:

Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.

*You Can put this in your own words

2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer

Answers

Answer:

C Respond to the environment

A mouse running away from the sound of an owl's wings is responding to the environment.

What are living organisms?

The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.

Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.

The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.

Therefore,  A mouse running away from the sound of an owl's wings is responding to the environment.

To learn more about sensitivity refer to the link:

https://brainly.com/question/14057226

#SPJ2

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

7. How does a beach mouse get its trait? The order of the process is:
A.RNA → Gene A → Protein A → Amino Acid → Fur color
B.Gene A → Amino Acid → Protein A → RNA → Fur color
C.Protein A → Amino Acid → RNA → Gene A →Fur color
D.Gene A → RNA → Amino Acid → Protein A → Fur color
E.RNA → Gene A → Amino Acid → Protein A → Fur color

Answers

D. Gene A - RNA-Amino Acid- Protein A- Fur Color. i believe this is correct

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

HELPPP PLEASEEE
4 ANNOTATE Use the correct terms to complete this diagram showing the reactants and
products for each chemical reaction.

Answers

Answer:

Explanation:

Photosynthesis

Reactants: Carbon dioxide and water

Products: Glucose and oxygen

Respiration

It's the opposite of photosynthesis:

Reactants: glucose and oxygen

Products: Carbon dioxide and water

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms
Other Questions
The ratio of boys to girls in class is 4 : 5 What fraction of the class are boys 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up (No linksssssssssssss)Pls help me~English ~Ill mark brainliest if correct A mans basic wage for a 40 hour week is 160 . He is paid 5 per hour for overtime .If he fors for 6.5 hours overtime in a certain week , his wages for that week is 1. An atom that loses electrons has a ________________________ charge and an atom that gains electrons has a ___________________________ charge.Charged atoms are called ___________________. 2. What is an insulator? Give 4 examples. 3. What is a conductor? Give an example. 4. How can we move electrons from one place to another? What actually causes the electrons to move? 5. Static electricity is ______________________________________________________________________ _______________________________________________________________________________________ 6. Explain the attraction and repulsion of charges. 7. Why does a balloon stick to the wall? 8. Why does your hair stand up when you take off your hat? 9. Why do you get a shock when you walk across a carpet? 10. When is static electricity most noticeable and why?11. State the Principle of Conservation of Charge. 12. The invisible electric force field around charged objects depends on __________________________, __________________________, and _____________________________. 13. What is the relationship between the charges and the field strength? What is the relationship between the field strength and the distance between the charges? 1. What is DC? What is AC? 2. Name 3 ways to get DC. 3. What is an electrical circuit? 4. What is voltage? What is current? What is resistance? What causes heat and light in a wire? COPY THE TABLE comparing water in a hose-DC-units 5. Which electricity do we use in our homes? CLICK ON ALTERNATING CURRENT 1. Explain AC. 2. Who invented the light bulb? 3. Who really invented AC? 4. Who discovered the advantages of AC over DC? 5. How is AC made? 6. What is the main advantage of AC over DC? plzzz help thank you guys sm! The circumference of a circle is 23 pi M what is the area in square meters express your answer in terms of pie 6.The rate of change is constant in each table. Find the rate of change. Explain what the rate of change means for the situation.A. 212; your car travels 212 miles.B. 1/53; Your car travels 53 miles every 1 hour.C. 53/1; Your car travels 53 miles every 1 hour.D. 10; your car travels for 10 hours. A claim is:the thesis statementThe position you are trying to get your readers to acceptfound in the introductionall of the above The dot plot shows a random sample of number of miles completed in a session by two different running clubs. Compare the mean values of the dot plots. Round to the nearest tenth. Which makes a comparative inference about the runners in both clubs?(A) There is about the same variation in the number of miles run by each member in both clubs.(B) There is less variation in the number of miles run by the members of Club Fit than by the members of Club Agile.(C) There is less variation in the number of miles run by the members of Club Agile than by the members of Club Fit. True or FalseThe most powerful empire between the 1500s and 1600s was the Ottoman Empire.O TrueFalse Find the discount savings on a bicycle that originallycosts $230 but is on sale for 40% off. Show yourwork. katangian ni Gilgamesh kung bakit siya itinuring na isang bayani sa Epiko. A group of scientists wants to investigate if they can predict the life expectancy of mammal species givenits average heart rate. The table below shows the relationship between average heart rate (in beats perminute) and life expectancy (in years) for a sample of mammals.WhaleElephantHorseLionSheepPigAverage heart rate (BPM)203034507595Life expectancy (years)707040131525All of the scatter plots below display the data correctly, but which one of them displays the data best?By convention, a good scatter plot uses a reasonable scale on both axes and puts the explanatory variable on thex- axis The area of a. square field is 100m square. what is the perimeter of the field? Are motivations for imperialism justifiable? (In other words, are any motivations for imperialism acceptable reasons for one country to influence other countries or territories through military force or other means of power?) Give me 3 sentence please!!! NO WORDS FROM THE INTERNET in your word what is the definition of cultural appropriation and how does it affect society/social media Pls help 20 points ! Which statements must be true to model a data set using a normal distribution?The sample mean must equal the population mean.The standard deviation of the population must be less than 30.The sample must be randomly selected.The sample size, n, must be at least 30.The population mean must be greater than the sample mean. 8. What is an example of a situation in which a shortage is caused by a change insupply?