Which kind of research is most likely to improve the health of the
environment?

Answers

Answer 1

Answer:

The environment   play a role in people mental and physical being.

Explanation:

Environment  quality and human health  remain factors and taking into multiple interactions economic and cultural context.

Environment through air pollution, chemicals, poor quality water and natural area loss, increase in rates obesity, diabetes, and diseases.

Environment factors are particular matter, environmental tobacco smoke leading,and indicative ranking of environmental impacts of health.

Environment across depend on the pressures relate to pollution and natural resources,pollution reduction and the natural environment distribute populations.

Environmental quality can be policy and population group, incomes, elderly and the educational status, environment burden they focus on health and complex causal path.


Related Questions

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

what are the major groups of animals and how to they differ

Answers

There are many living things in the world. To keep them simple and easier to remember, the scientists had identify many groups of animals. The six main groups are: invertebrates, mammals, birds, amphibians, reptiles and fish.

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

why it is necessary to water the plant for experiment​

Answers

Answer:

To activate the process of germination.

Explanation:

So the plants can get the whole photosynthesis step because it need sunlight and water to continue to grow.

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

____is associated with deamination of protein​

Answers

Answer:

Deamination is the removal of an amino group from a molecule

Deamination is associated with deamination of protein​

Answer:

in humans , deamination  takes place primarily in the liver, it can also occur in the kidney. if there's excess protein intake , deamination is used to break down proteins with amino acids for energy

Only ------ percent of the food eaten is turned into its own body. *



20%

12%

10%

40%​

Answers

Answer:

12% I think this is right answer v

guy plz chat with me

Answer:

the answer is 10%

Explanation:

the 10% rule states that only 10% of energy is passed from one trophic level to the other (organism to organism)

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

The image shows a food web in an Arctic ecosystem. Rising temperatures in the Arctic Ocean can lead to large die-offs of phytoplankton, which are autotrophs. What would most likely happen in an Arctic ecosystem if the phytoplankton population decreased?

Answers

Answer:

as the population of phytoplankton decreases, the amount of food for zooplancktons decreases

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

Which of the following is a distinct structure found specifically in the liver, spleen, and bone marrow?
Select one:
a. Sinusoidal capillaries
b. Fenestrated capillaries
c. Venous sinus
d. AV anastomoses
e. Continuous capillaries​

Answers

Answer:

option A is correct

Explanation:

Which of the following is not a negative consequence of upward urban growth?
a pollution
b creation of a "heat island"
C. increased use of surrounding land
d. waste management issues
Please select the best answer from the choices provided
A
OOOO

Answers

Answer: I believe its C

Explanation:

Answer:

C. increased use of surrounding land

Explanation:

Edge2021

which type of cell(s) contain ribosomes?

Answers

Answer:

Ribosomes are found in prokaryotic and eukaryotic cells; in mitochondria, chloroplasts and bacteria. Those found in prokaryotes are generally smaller than those in eukaryotes. Ribosomes in mitochondria and chloroplasts are similar in size to those in bacteria. hope this is good enough to help you

Explanation:

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Other Questions
What is the image point of (-5,9) after a translation left 1 unit and down 1 unit? A catering company prepared and served 375 meals at an anniversary celebration last week using 3 workers. The week before, 2 workers prepared and served 225 meals at a wedding reception a1. Calculate the labor productivity for each event. (Round your answers to 1 decimal place.) Anniversary Wedding meals/worker meals/worker a2. For which event was the labor productivity higher? Anniversary Wedding What is the best pregame meal for an athlete? A. chips and a sport drink B. hamburger with fries and a soda C. pasta with meat sauce, fruit, and milk D. steak dinner with vitamin water Abby's therapist and Abby have developed a hierarchy of social situations that range from not very threatening to very threatening. The therapist's strategy is to start with the least threatening and work up to assist Abby in not being so sensitive to rejection, to improve Abby's sense of unworthiness, and to assist her in having more relationships with others. This is a description of using _____ _____ to treat Abby's diagnosis of avoidant personality disorder. if a source of sound waves is rabidly approaching a person the sound heard by the person appears to have? A group of fitness club members lose a combined total of 28 kilograms in 1 week. There are approximately 2.2 pounds in 1 kilogram. Assuming the weight loss happened at a constant rate, about how many pounds did the group lose each day? What is the measure of FEG? A. 30 degrees B. 40 degreesC. 50 degreesD. 70 degreesPlease include ALL work!! Find the next three terms in the geometric sequence. Which expression is equal to (1+6i)(7+3i) ? An emerging adult who makes significant gains in postformal thinking is more likely to operate from the core belief that her beliefs are: Carpenter Corporation uses the weighted-average method in its process costing system. This month, the beginning inventory in the first processing department consisted of 2,400 units. The costs and percentage completion of these units in beginning inventory were: 2 points Percent Complete 60% 55% Cost $ 7,000 $10,300 Materials costs Conversion costs 01:53:47 A total of 10,500 units were started and 8.900 units were transferred to the second processing department during the month. The following costs were incurred in the first processing department during the month: eBook Materials costs Conversion costs $ 96,800 $171,000 References The ending inventory was 85% complete with respect to materials and 70% complete with respect to conversion costs. How many units are in ending work in process inventory in the first processing department at the end of the month? a. 4,000 b. 1,800 c. 8.100 d. 1,600 a rectangle is 12 in wide and 18 in tall.if it is reduce to a height of 3 inches, then how wide will it be? An arrangement where a property developed by the seller is sold to a buyer. The seller retains occupancy of the premises by signing a lease with the buyer. The seller, now the tenant, pays taxes, utilities, insurance and operating costs. This is called a ___________. This is a common practice for Walmart and Rite-Aide and many other businesses Group of answer choices sale rental agreement net lease investment lease-purchase option nome of the other answers Beatty justifies the new role of firemen by claiming to be "custodians of [society's] peace of mind, the focus of [the] understandable and rightful dread of being inferior." What do you think he means by this? coefficient of 8x+7y "What is the difference between the revertible and nonrevertible rII mutants that Benzer generated?" Write the expression 12-2 in simplest form. A new fast-food firm predicts that the number of franchises for its products will grow at the rate dn dt = 6 t + 1 where t is the number of years, 0 t 15. What is systems thinking? identifying the different parts of a system describing how the parts of a system work together analyzing how things outside a system influence the things in that system thinking about how things influence each other within a system __________________ numbers are used to say the order in which people, things, or events show.