Which is the sum of the sequence {5*1, 5*8, 5*27, 5*64, 5*125, 5*216}?

Answers

Answer 1

Answer:

2160

Step-by-step explanation:

I find that it is easier to split the sequence into smaller, more manageable sections. For numbers beyond 13, the simplest way is to split it up into place values.

Note: * is a multiplication symbol

5*1 = 5

5*8 = 40

5*27 = (5*20) + (5*7) = 100+35 = 135

5*64 = (5*60) + (5*4) = 300+20 = 320

5*125 = (5*100) + (5*20) + (5*5) = 500+100+25 = 625

5*216 = (5*200) + (5*10) + (5*6) = 1000+50+30=1080

Now you can add all of the totals up!

135+320+625+1080 = 2160


Related Questions

find the length of y, assume the triangles are similar

Answers

Answer:

y = 3.6

Step-by-step explanation:

Since the triangles are similar, we can write the following proportion:

[tex]\frac{y}{6.3} = \frac{2.4}{4.2} = \frac{2.8}{x}[/tex]

We don't need the fraction on the left because it is not necessary to solve for y. Instead, we can simplify the rest:

[tex]\frac{y}{6.3} = \frac{2.4}{4.2}[/tex]

[tex]\frac{y}{6.3} = \frac{0.4}{0.7}[/tex]

Now, we can cross-multiply:

[tex]0.7y = 6.3 * 0.4[/tex]

[tex]0.7y = 2.52[/tex]

[tex]y = 3.6[/tex]

Given:

The length of both triangle are in the same ratio,

2.4:2.8:y = 4.2:x:6.3

To find:

The value of 'y'

Steps:

Since 2.4 : y = 4.2 : 6.3, we can find the value of 'y'

    2.4/y = 4.2/6.3

2.4 * 6.3 = 4.2 * y

     15.12 = 4.2y

15.12/4.2 = y

        3.6 = y

            y = 3.6

Therefore, the value of y is 3.6

Happy to help :)

If you want help, feel free to ask

PLEASE ANSWER I WILL GIVE BRAINLIEST FAST

Answers

Answer:

E &F

Step-by-step explanation:

The rules of a 30-60-90 Triangle is E, and F is just a different value of numbers (but the same ratio).

Help pls 20 POINTS math

j/−2+7=−12

Answers

Answer:

J = 38

Step-by-step explanation:

j/-2 + 7 = -12

j/-2 = -19

j = 2 • 19

j = 38

Answer:

Step-by-step explanation:

j/-2 =-12-7

j=(-19)*(-2)

j=38

MIN-
Bill is measuring a piece of material for some curtains.
It is 215 cm wide, how many mm is this?
There are 10 mm in 1 cm.
mm

Answers

Answer:

2,150 mm

Step-by-step explanation:

If every cm is 10 mm you multiply 215 by 10. I hope this helped!

2,150mm.

Explanation:

Let’s take away the “mm” and “cm” for now. Since 10mm = 1cm, it’s basically multiplying by 10 to the number or adding a 0 behind the number. This means that if you take 215 cm and multiply it by ten, you will get the number 2,150, which is the mm equivalent of 215 cm. You can also use this for many other equations. This is called conversion.

Hope this helps you understand!

Write the sentence as an inequality. The cost of a ticket t will be no more than $52.

Answers

Answer:

t is less than or equal to $52, or t <= $52

Step-by-step explanation:

If you can't have more than $52, then use less than symbol (<). The sentence doesn't state that a ticket shouldn't cost $52, so it's safe to assume that you can have exactly $52.

I need two examples of a decimal number to the tenths place minus a decimal number to the hundredths place. Show all work

Answers

Answer:

ok

Step-by-step explanation:

.1 - .01 = .99

.1 - .99 = .1

.4 -.03 =37

1
Select the correct answer.
Simplify the following expression.

O A.
OB. 12
Oc. 1
OD.
64
Reset
Next

Answers

Answer:

1/64

Step-by-step explanation:

4^ (-11/3) ÷ 4 ^ (-2/3)

We know a^b ÷a^c = a^(b-c)

4 ^(-11/3 - - 2/3)

4^(-11/3 +2/3)

4^(-9/3)

4^ -3

We know a^-b = 1/a^b

1/4^3

1/64

which of the following is equivalent to the expression 2√(9a^3b^4c)

A) 6ab^2√(ac)
B) √(18ab^2c)
C) 18abc√(a^2b^3)
D) 6a^2b^2√(ac)

Answers

Hello!

2√9a³b⁴c =

= 2 × 3ab²√ac =

= 6ab²ac

Answer: A) 6ab²√ac

Good luck! :)

Find the mass of wire that lies along the curve , ()=(2−1)+2, 0≤≤ 1, h = (3)

Answers

Step-by-step explanation:

sorry bestie but it hard to find

Evaluate −a2+c2 when c=−4.

Answers

Answer:

[tex]a = 4, -4[/tex]

Step-by-step explanation:

Step 1:  Plug in -4 for c

[tex]-a^{2} + c^{2}[/tex]

[tex]-a^{2} + (-4)^{2}[/tex]

[tex]-a^{2} + 16[/tex]

Step 2:  Solve for a

[tex]-a^{2}+16-16=0-16[/tex]

[tex]-a^{2}/-1 = -16/-1[/tex]

[tex]a^{2} = 16[/tex]

[tex]\sqrt{a^{2}} = \sqrt{16}[/tex]

[tex]a = 4, -4[/tex]

Answer:  [tex]a = 4, -4[/tex]

consumer product manufacturers, link with customer satisfaction surveys and product warranty cars that are sent back to the company. And Outdoors company redesign the popular camping tent, and it wants to know what does the customers like the newer version rather than older one. So they include in the warranty registration of car to serve it as two questions first one of the customer on the older version of the tent and the second newest version better what variable was measured by this experiment ​

Answers

Answer:

sorry

Step-by-step explanation:

Use the distributive property to remove the parentheses.
-5(6u - 4w-2)

Answers

Answer:

-30u + 20w + 10

Step-by-step explanation:

Answer:

-30u+20w+10

Step-by-step explanation:

multiple each term inside the parenthesis by -5. remember negative times negative = positive

José corrió 3/10 Kilómetros y Juan 1/2 kilometro

¿Cuántos kilómetros corrieron entre los dos?

Answers

Answer:

3/10 + 5/10 = 8/10

8/10 kilometers

Step-by-step explanation:

Answer:

3/10+1/2=3/10+5/10

=8/10km

Find the missing side lengths leave your answer as a racials simplest form

Answers

Answer:

u = 26

v = 13√3

it's 30-60-90 triangle

Which of the following is NOT equivalent to 22/7?
a) 2 + 8/7
b) 1 + 15/7
c) 3 (7/1) + 1/7
d) 3 (7/7) + 1/7

Answers

Answer:

the option c is the answer for this question

The brand manager for a brand of toothpaste must plan a campaign designed to increase brand recognition. He wants to first determine the percentage of adults who have heard of the brand. How many adults must he survey in order to be 90​% confident that his estimate is within five percentage points of the true population​ percentage? ​b) Assume that a recent survey suggests that about 87​% of adults have heard of the brand.

Answers

Answer:

He must survey 123 adults.

Step-by-step explanation:

In a sample with a number n of people surveyed with a probability of a success of [tex]\pi[/tex], and a confidence level of [tex]1-\alpha[/tex], we have the following confidence interval of proportions.

[tex]\pi \pm z\sqrt{\frac{\pi(1-\pi)}{n}}[/tex]

In which

z is the z-score that has a p-value of [tex]1 - \frac{\alpha}{2}[/tex].

The margin of error is:

[tex]M = z\sqrt{\frac{\pi(1-\pi)}{n}}[/tex]

Assume that a recent survey suggests that about 87​% of adults have heard of the brand.

This means that [tex]\pi = 0.87[/tex]

90% confidence level

So [tex]\alpha = 0.1[/tex], z is the value of Z that has a p-value of [tex]1 - \frac{0.1}{2} = 0.95[/tex], so [tex]Z = 1.645[/tex].

How many adults must he survey in order to be 90​% confident that his estimate is within five percentage points of the true population​ percentage?

This is n for which M = 0.05. So

[tex]M = z\sqrt{\frac{\pi(1-\pi)}{n}}[/tex]

[tex]0.05 = 1.645\sqrt{\frac{0.87*0.13}{n}}[/tex]

[tex]0.05\sqrt{n} = 1.645\sqrt{0.87*0.13}[/tex]

[tex]\sqrt{n} = \frac{1.645\sqrt{0.87*0.13}}{0.05}[/tex]

[tex](\sqrt{n})^2 = (\frac{1.645\sqrt{0.87*0.13}}{0.05})^2[/tex]

[tex]n = 122.4[/tex]

Rounding up:

He must survey 123 adults.


The value of the expression 23 +32–3x4–52-5+(7x4) is

Answers

Answer:

24

Explanation:

(23+32)-(3×4)-(52-5)+(7×4)

(55)-(12)-(47)+(28)

55-12=43-47+28= -1943-19=24

Ron deposits $2,000 into an account that receives 3.1% interest compounded continuously. How much money is in the account after 9 years?
A.) $2,623.70
B.) $2,632.44
C.) $2,643.61
D.) $2,605.83

Answers

Answer

i think it's C. $2,643.61

7/18 - 1/3 , 1/2 - 1/5 - 1/10 and 3 1/2 - 2 5/9 please help thank you ​

Answers

Answer:

Step-by-step explanation:

7/18=7/18

it cant be divided agian

1/3=1/3

it cant be divded agian

1/5=1/5

it cant be divded agian

1/10=1/10

it cant be divded agian

3 1/2=3/2

2 5/9 =10/9

i am not sure if this is what you wanted ...

what is the sum of the angles of a triangle?

Answers

THE SUM OF ANGLES OF TRIANGLE IS 180 DEGREE.

Calculus 3 Problem

7. Determine if the field F(x, y, z) = ye^z i + xe^z j + xy e^z k is conservative. If it is, find a potential function.​

Answers

Step-by-step explanation:

Given:

[tex]\vec{\textbf{F}}(x, y, z) = ye^z\hat{\textbf{i}} + xe^z\hat{\textbf{j}} + xye^z\hat{\textbf{k}}[/tex]

A vector field is conservative if

[tex]\vec{\nabla}\textbf{×}\vec{\text{F}} = 0[/tex]

Looking at the components,

[tex]\left(\vec{\nabla}\textbf{×}\vec{\text{F}}\right)_x = \left(\dfrac{\partial F_z}{\partial y} - \dfrac{\partial F_y}{\partial z}\right)_x[/tex]

[tex]= xe^z - ye^z \neq 0[/tex]

Since the x- component is not equal to zero, then the field is not conservative so there is no scalar potential [tex]\phi[/tex].

Select the correct answer. This table represents a quadratic function. x y 0 -3 1 -3.75 2 -4 3 -3.75 4 -3 5 -1.75


I really need one fast
I give all my points​

Answers

Answer:

1/4

Step-by-step explanation:

that is the answer

I found the constant which was -3

a = 1/4

b=-1

Answer:

the value of a in the function's equation is 1/4

Step-by-step explanation:

Plato answer


A road crew must repave a road that is 2/3 miles long. They can repave 1/12 miles each hour. How long will it take the crew to repave the road?

Write your answer in simplest form.

Answers

Answer:

8 hrs

Step-by-step explanation:

2/3 = 8/12

1/12 each hour

It will take 8 hours
Answer:8 hours
First make both fractions have common denominators: 1/12 and 8/12
Solve the equation 8/12 = 1/12x; so x equals 1/8 meaning each hour they can repave 1/8 of the total. So the amount of hours it takes to repave the road is 8

plot the following points in the number line, -1/4, 1 1/2, 0.75 (PLS ANSWER ASAP)

Answers

Answer:

-1/4 is the least, 0.75 is second, and 1 1/2 is the greatest

Step-by-step explanation:

-1/4 is the least already because it is negative.

1 1/2 is really 1.5 so now compare 0.75 and 1.5.

1.5 is bigger therefore the order  is :

-1/4, 0.75, 1 1/2

6. The area of a rectangular sheet of paper is 300 cm squared. The length is 5 cm more than the width
a) If the width of the rectangle is x cm, state an expression for the length of the rectangle.
b) Write and algebraically solve a quadratic equation to determine the length and
width of the rectangle.

Answers

Answer:

Step-by-step explanation:

width = x

length= x + 5

a)  x + 5

b) x * (x+5) = 300

x^2 + 5x = 300

x^2 + 5x - 300 = 0

Δ = 25 + 1200 = 1225

width = (-5 + 35)/2 = 15 cm

lenght = 15 + 5 = 20 cm

Answer:

a) length = x + 5  

b) [tex]x^{2}[/tex] + 5x - 300 = 0

Step-by-step explanation:

x = width

x + 5 = length

(x)(x + 5) = 300

[tex]x^{2}[/tex] + 5x = 300

[tex]x^{2}[/tex] + 5x - 300 = 0

(x+20)(x-15)

x = -20 or x = 15  ( disregard the -20. measurements can't be negative)

width = 15

length = x+ 5 =  15+5 = 20

I need two examples of Solve a proportion with a mixed number in one of its numerators. SHOW ALL WORK!!!!!!!!!!!!

Answers

Answer:

A proportion equation is something like:

[tex]\frac{A}{B} = \frac{x}{C}[/tex]

Where A, B, and C are known numbers, and we want to find the value of x.

Now we want two cases where in one of the numerators we have a mixed number, where a mixed number is something like:

1 and 1/3

which actually should be written as:

1 + 1/3

1) a random problem can be:

[tex]\frac{1 + 1/3}{4} = \frac{x}{5}[/tex]

We can see that the numerator on the left is a mixed number.

First, let's rewrite the numerator then:

1 + 1/3

we need to have the same denominator in both numbers, so we can multiply and divide by 3 the number 1:

(3/3)*1 + 1/3

3/3 + 1/3 = 4/3

now we can rewrite our equation as:

[tex]\frac{4/3}{4} = \frac{x}{5}[/tex]

now we can solve this:

[tex]\frac{4/3}{4} = \frac{4}{3*4} = \frac{x}{5} \\\\\frac{1}{3} = \frac{x}{5}[/tex]

now we can multiply both sides by 5 to get:

[tex]\frac{5}{3} = x[/tex]

Now let's look at another example, this time we will have the variable x in the denominator:

[tex]\frac{7}{12} = \frac{3 + 4/7}{x}[/tex]

We can see that we have a mixed number in one numerator.

Let's rewrite that number as a fraction:

3 + 4/7

let's multiply and divide the 3 by 7.

(7/7)*3 + 4/7

21/7 + 4/7

25/7

Then we can rewrite our equation as

[tex]\frac{7}{12} = \frac{25/7}{x}[/tex]

Now we can multiply both sides by x to get:

[tex]\frac{7}{12}*x = \frac{25}{7}[/tex]

Now we need to multiply both sides by (12/7) to get:

[tex]x = \frac{25}{7}*\frac{12}{7} = 300/49[/tex]

Find the perimeter and area of a square with sides 6 inches in length.

Answers

Area is 36
And the perimeter is 24


(a). Find the value of log 216.

Answers

Answer:

2.334453751

Step-by-step explanation:

Press log on your Casio calculator (if you have one) and plug in 216, then close the parentheses!

i spend 3 hours a day out of a 8 hour shift, what percentage is that

Answers

Answer:

0.375 = 38%

Step-by-step explanation:

Just divide 3 from 8 and that will give you 0.375

Then you round that to the nearest  one which is 38 and

that will get your percentage

Answer: 37.5%

Step-by-step explanation: I just divided 3 by 8 then once I got my answer I moved the decimal point over to the right by 2.

How do u determine the equation of the line through each pair of points in slope-intercept form (y=mx+b). (3,0) and (2,4) (-6,3) and (2,-2)​

Answers

Answer:

Y =-4X +12

Y =-0.625X  -0.75

Step-by-step explanation:

(3,0) and (2,4)....

x1 y1  x2 y2

3 0  2 4

   

(Y2-Y1) (4)-(0)=   4  ΔY 4

(X2-X1) (2)-(3)=    -1  ΔX -1

   

slope= -4          

B= 12          

   

Y =-4X +12    

~~~~~~~~~~~~~~~~~

(-6,3) and (2,-2)​

x1 y1  x2 y2

-6 3  2 -2

   

(Y2-Y1) (-2)-(3)=   -5  ΔY -5

(X2-X1) (2)-(-6)=    8  ΔX 8

   

slope= -  5/8    

B= -  3/4    

   

Y =-0.625X  -0.75    

Other Questions
The scores on a standardized test are normally distributed with a mean of 80 and standarddeviation of 5. What test score is 0.9 standard deviations above the mean? One year the ACT had a mean score of 21.2 and a standard deviation of 5.1. That same year, the SAT had a mean score of 1498 and a standard deviation of 347. Suppose that a scholarship committee is considering two students, one who scored 26 on the ACT and another who scored 1,800 on the SAT. Both are pretty good scores, but which one is better? Find the z-score for the ACT Question 4 Vered just got off the phone with an old classmate who was very excited. That classmate had purchased a business with low operating cash flow, just $1,000 last year. However, they had just made a big investment and thus depreciation would be increasing by $50,000 next year. The investment had cost $300,000. They expect to use it for five years and then sell the item for $50,000. They said that would be very helpful since the large increase in depreciation would increase cash from operations. They are thinking of taking this information to a bank for a loan, but have asked Vered to check their numbers. By how much should Vered tell them this will increase cash from operations Cual es el rol de la televisin,la radio y la prensa escrita en la conformacin de valores en la sociedad actual Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a. Which of the following is the solution set of 6x + 5 = -29? {-4} The probability that Sara wins a raffle is given by the expression n/n+3Write down an expression, in the form of a combined single fraction, for the probability that Sara does not win. Which headline is most likely to be included on a national news show?A. Local school raises $5,000 for cancer researchB. Iran declares war on the U.S.C. School in China raises $5,000 for cancer researchB. Company closes in Alaska, lays off 2 people Ibrahim likes to run a loop around the park near his house that is mile long. There is a water fountain way around the loop. Ibrahim stopped to get a drink of water at the water fountain. How far did Ibrahim run? Carbon monoxide, a product of combustion, is a toxic gas that has an extremely high affinity for hemoglobin (much higher than that of oxygen for hemoglobin); consequently, as soon as it dissolves in the liquid part of blood at low partial pressure, it diffuses quickly into red blood cells and binds to hemoglobin. In carbon monoxide (CO) poisoning, even with very low partial pressure of inspired CO, CO rapidly binds to hemoglobin (Hgb), leaving a lower fraction of oxygen binding sites on Hgb available to be occupied by oxygen. What would you expect to find if you measure the arterial PO2 of a person with CO poisoning Write about the urban local government bodies. Which of the following is one of the value gaps that can undermine customer experiences and can damage relationships?Service Quality GapsPsychological GapsLanguage GapsPhysical GapsOperational GapsTransition Gaps the product 17.10 Analyze the diagrams. Which quadrilateral is a trapezoid? Quadrilateral M N O L is shown. Sides M L and N O are parallel and sides M N and L O are parallel. Quadrilateral M N P O is shown. Quadrilateral A B C D is shown. Sides A D and B C are parallel. The doctrine of respondeat superior means that: a. the police are expected to respond immediately to all calls for service b. an employer may be held liable for the wrongful acts of its employees c. the federal court may assume jurisdiction over police misconduct suits involving constitutional violations d. police officers have sovereign immunity and cannot be sued for damages caused by their misconduct Bshehe svevsbehxuebxhebxhebdbdb The function g(x) = x2 is transformed to obtain function h: h(x) = g(x 3). Which statement describes how the graph of h is different from the graph of g? A. The graph of h is the graph of g horizontally shifted right 3 units. B. The graph of h is the graph of g horizontally shifted left 3 units. C. The graph of h is the graph of g vertically shifted up 3 units. D. The graph of h is the graph of g vertically shifted down 3 units. (Super urgent) I need to know which one of the 4 the answer is Frogs are released into a pond where there are no other frogs of this species. Thefunction f(t) can be used to model the population of this new species after t years.Below are 4 forms of the function that model this situation. Which form most clearlyshows the monthly population growth? the sale figures have been revised ....... due to the miscaculationa, significantb,significantlyc,significanced,signification