Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals

Answers

Answer 1

Answer:

definitely D because a rainforest is extremely vast when it comes to different species

Explanation:

brainliest plz?

Answer 2

The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.

What is ecosystem?

An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.

It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.

The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.

For more details regarding ecosystem, visit:

https://brainly.com/question/15011558

#SPJ6


Related Questions

o
1. Which criteria are used to classify amphibians into orders?

Answers

Answer:

They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.

Approximately 8,100 species of living amphibians are known. First appearing about 340 million years ago during the Middle Mississippian Epoch, they were one of the earliest groups to diverge from ancestral fish-tetrapod stock during the evolution of animals from strictly aquatic forms to terrestrial types. Today amphibians are represented by frogs and toads (order Anura), newts and salamanders (order Caudata), and caecilians (order Gymnophiona). These three orders of living amphibians are thought to derive from a single radiation of ancient amphibians, and although strikingly different in body form, they are probably the closest relatives to one another.

6. A characteristic common to both diffusion and active transport is that
the movement of molecules occurs
energy is needed
oxygen is moved across a membrane
O
molecules move from low concentration to high concentration

Answers

Answer:

oxygen is moved across a membrane O, cause the others are untrue.

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

What events must have occurred for fossils of marne organisms to be in a mountain far above sea level?​

Answers

Answer:

el sapo

Explanation:

(GIVING BRAINLIEST) ______________ energy is the total potential and kinetic energy of particles in an object.
Group of answer choices

Chemical

Nuclear

Thermal

Answers

Answer:

Thermal

Explanation:

The total kinetic and potential energy of the particles in an object is called thermal energy.

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

PLEASE HELPPPPPPP

(Monstro the Goldfish & Epigenetics)

Answers

Answer:

mmmmmmmmmmmmdddddd

Explanation:

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

please help i will give brainlist

Answers

Answer:

I think it's c hope I hope I helped if not I'm sorry:(

Option B is i hope
I think it is

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

Can someone please help me

Answers

Answer:

carbon dioxide plus water in the presence of light energy to sugar and oxygen

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

PLSPLSPLS HELP ASAP



a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.

In what two ways can the minnow population be used to monitor the Lakes water quality?

Answers

Answer:

In the above case we can understand that,

If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.

Answer:  The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."

Explanation:

I got it right.

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

if you step on a sharp object muscles in your leg will rapidly put your foot away.


what is the correct term for this type of reaction?​

Answers

Answer:

Explanation:

Sharp object the reaction is a reflex its involuntary and it doesn't involve ur brain it protects u from damage.So u step on the sharp object whihc is a stimulus so the reaction is reflex its quick and automatic.

Hope this helps

Reflex arcs can also be more complex. For example, consider what happens when you step on a sharp object. As in the example above, a sensory (pain) neuron carries an impulse to an interneuron in the spinal cord. The interneuron synapses with motor neurons which pull your foot away from the sharp object, just as in the example above. However, if that was all that happened you would probably fall over! The interneuron also synapses with motor neurons which control the muscles of the other leg. These muscles adjust your position so you do not fall. The interneuron synapses with still other neurons, which carry the information about what has happened to the cerebellum (which coordinates the muscular activities) and the cerebrum, so that you become "conscious" of what has happened and can take further voluntary action.

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

What increases as you move from the surface to the interior of the Earth?

Answers

Answer:

Heat/temperature

Explanation:

"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

please answer this!!

Answers

Answer:

mouth coughing out biok sid carbon

Other Questions
Calculate the correlation coefficient, r, for the data below. Which fraction and decimal forms match the long division problem? A.4/15 and 0.26 B.4/15 and 0.26 C.15/4 and 0.266 D.15/4 and 0.26 Find the slope intercept equation of the line How do you write 872.8% as a decimal? Please I need helpWhat is the perimeter of the parallelogram Does the order of operations apply to algebraic expressions? GIVING AWAY 38 POINTSExplain the three properties of sound. whats 10424123^2. yep have fun Jody works at an ice cream counter. The ice cream costs $3 per cone. Let c represent the number of ice cream cones she sells. Let p representthe total cost paid by the customers.Choose two correct statements about the variables in this situation,A. The cost per cone depends on the number of cones sold.B. The total cost paid by customers depends on the number of cones sold,O c The number of cones sold is independent of the total cost paid by customers.D. The total cost paid by customers is independent of the number of cones sold, Write the relation as a set of ordered pairs.A relation. An arrow goes from negative 2 to 4, 0 to 0, 2 to 4.a.ordered pairs: {(4, 2), (0, 0), (2, 4)}b.ordered pairs: {(2, 4), (0, 0), (4, 2)}c.ordered pairs: {(2, 4), (0, 0), (2, 4)}d.ordered pairs: {(4, 2), (0, 0), (4, 2)} Gabuat Corporation, which has only one product, has provided the following data concerning its most recent month of operations:Selling price $147Units in beginning inventory 0Units produced 2,200Units sold 1,910Units in ending inventory 290Variable costs per unit: Direct materials $47Direct labor $34Variable manufacturing overhead $5Variable selling and administrative expense $6Fixed costs: Fixed manufacturing overhead $39,600Fixed selling and administrative expense $15,280The total gross margin for the month under the absorption costing approach is:________ Which activity can be accomplished using the genetic code?O A polypeptide can be made into mRNA. DNA can be made into mRNAO RNA can be copied before mitosis.O mRNA can be made into tRNA What does Sandy recommend in order to escape?to free-fallto hit the yellow buttonto turn a sharp right Refer to your Expeditions in Reading book for a complete version of this text.Read the excerpt from A Ride in the Night.The soldier called Brown turned toward Will. His eyes were cold and dangerous. He twisted Wills shoulder crudely. Were on the lookout for horses intended for the Continental Army. Do you know anything about them? Ouch! Youre hurting me! The mans roughness had brought real tears to Wills eyes. The boy was glad of it. The pain would excuse the look of fear on his face. But his great fear was for York, hidden back in the woods with the horses.Based on the details in the excerpt, which inference can be made about Will?A He cares about others' safety more than his own.B Will is easily bullied by people who are older and stronger.C He worries most about what will happen to the horses.D Will is trying to make the soldier feel sorry for him by crying out. Without looking, Luke picks necklace beads from a bag of 52 beads. Half the beads are rough. The other half are smooth. There are 13 red beads, 13 blue beads, 13 green beads, and 13 black beads.What is the theoretical probability of selecting a rough bead? Help?^-^ Will Give Brainliest! What is the medical term for the process or procedure that destroys or inhibits disease-causing microorganisms to prevent infection: What two human systems deal with allergies? A body cell has been growing and synthesizing proteins. In the nucleus of this body cell, DNA replication is taking place, and a copy of the cell's genetic material is copied. Which of the following is the best conclusion you can make about the life cycle of this cell? To prepare for the test, Andrew takes notes and studied.Which answer corrects the error in verb tense?Question 1 options:To prepare for the test, Andrew took notes and studied.To prepare for the test, Andrew was taking notes and is studying.To prepare for the test, Andrew took notes and is studying.To prepare for the test, Andrew takes notes and will study.