When the ranges of two different species meet, a stable "hybrid zone" occupied by hybrid individuals may form. How is this possible? When the ranges of two different species meet, a stable "hybrid zone" occupied by hybrid individuals may form. How is this possible? Two diverged populations are capable of mating and producing viable and fertile offspring. Hybrid individuals may have reduced fitness and thus be strongly selected against. Hybrid individuals are always allopolyploid and are thus unable to mate with either of the original species. One species has a selective advantage, so as hybridization continues, the other species will go extinct.

Answers

Answer 1

Answer:

Two diverged populations are capable of mating and producing viable and fertile offspring.

Explanation:

Although the biological concept of species says that two different species can not mate and produce viable fertile descendants, the hybrid zones are characterized for being an area where two different genetically groups meet and reproduce. These groups might be the same or different species.

This is a frequent phenomenon in nature, and widely common geographically and among taxonomic groups. It is not rear that different sympatric populations, with a short time of divergence and similar reproductive strategies, can hybridize and even generate new populations that get reproductively isolated from their parentals.

When talking about sympatry we refer to two similar species that coincide in part or their whole distribution area.  

These new populations are even morphologically different from the parental forms, which allow them to colonize new habitats and niches, promoting diversification.

Hibridation zones are very important to conserve, just because they are points of genetic diversity generation and diversification areas.

Answer 2

When the ranges of two different species meet, a stable "hybrid zone" occupied by hybrid individuals can form. This is possible because hybrid individuals are always allopolyploid and therefore are unable to mate with any of the original species, to understand more we need to know that......

Hybrid animals

Hybridization, that is, the process through which different species reproduce, generating an offspring, is not considered a very common phenomenon in nature. This is because, in general, species have a distinct number of chromosomes, the cell structures that contain genes. These differences in the number of chromosomes can make the development of the embryo unfeasible, as the alignment of equivalent chromosomes from the female and the male are necessary for the division of the fertilized cell to occur. When this alignment does not occur, the cell does not reproduce and dies. However, in some cases, even with the lack of chromosome pairs, reproduction between different species is successful, generating the hybrid. However, the birth of the individual does not mean that its survival is guaranteed. Often, the hybrid generated is weaker than its parents and does not survive; in other cases, the hybrid can adapt better to the environment than the species that conceived it.

With this information, we can conclude that hybrid animals are a cross between two different species, but this hybrid can have several complications for its survival.

Learn more about  Hybrid animals in https://brainly.com/question/32314


Related Questions

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Mendel always got close to a 9:3:3:1 ratio for phenotypes in the F2 generation of any dihybrid cross. If false, make it a correct statement

a. True
b. False

Answers

Answer:

True

Explanation:

It is true that Mendel always got close to a 9:3:3:1 ratio for phenotypes in the F2 generation of any dihybrid cross. This validates his law of independent assortment of genes.

The 9:3:3:1 is usually gotten from any dihybrid cross of F2 generation. The results given are always 9 offsprings containing dominant traits, 3 offsprings each which possess a dominant and recessive trait and 1 offspring with a recessive trait.

The arrangement of leaves on a tree branch that reduces overlapping and overshadowingof leaves from sunlight is referred to as leaf …………………………………………………………This ensures exposure of most of the leaves to sunlight for maximum ……………………………………………..to take place in the ………………………………………………………………………of leaf cells. The grana contains numerous……………………………………………molecules which trap light………………………………….for ………………………………………………….of water, producing ………………………………………atoms required for the process of carbon (IV) oxide…………………………………………………………in the light……………………………………………………………stage of photosynthesis which takes place in the……………………………………………..of the chloroplast.

Answers

Answer:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Explanation:

The arrangement of leaves that provide maximum exposure to sunlight is referred to as leaf phyllotaxy that reduces overlapping and overshadowing of leaves and supports maximum photosynsthesis.

The contains numerous chlorophyll molecules that trap the light energy for the oxidation of water and producing oxygen (O2) atoms required for carbon (IV) oxide reduction in light-independent, which takes place in the stroma of the chloroplast.

Hence, the correct answer in a sequential manner is as follows:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Consider a system in which low levels of protein "Q" triggers production of hormone A. The reaction of target cells of hormone A is to produce and release hormone B, which stimulates production of hormone C. In response to hormone C, the target cells up-regulate protein Q. In this scenario we see an example of _____.

Answers

Answer:

Negative feedback

Explanation:

Negative feedback is produced when a mechanism is amplified through an inverse loop, which tends to reduce the fluctuations in the system. In this case, the negative feedback mechanism represents a homeostatic response of the body where the release of a target hormone (hormone C) decreases in response to the increase of a protein (protein Q) upstream in the signaling pathway. Therefore, in this scenario, it is expected that negative feedback causes a decrease in hormone function.

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

what is the si unit of energy​

Answers

Answer:

Joule

Explanation:

Answer:

- the Joule (J)

Explanation: The Si unit of energy is the same as the unit of work. In slightly more fundamental terms, 1 joule is equal to 1 newton metre and, in terms of SI base units.

Some food material is given
below. What are the diffrent
possible ways of cooking them?
Find out and write them.
Meat - Groundnuts - Potatoes
Spinach​

Answers

Answer:

Meat-Boiling, Grilling, frying and roasting

Groundnuts-frying,boiling

Potatoes-Boiling frying and roasting

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

What percentage of the Earth's surface do forests cover? 20% 30% 40% 10%

Answers

30% of the earth's surface is covered by forests.

----------------------------------------------------------------------------------------

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

2 ypes of waste liquid and solid

Explanation:

biodegradable waste can be found in municipal soild waste or sometimes called biodegradable municipal waste ,or as green waste ,food waste,paper waste and biodegradable plastic.other biodegradable waste include human waste ,manure,sewage,sewage sludge and slaughterhouse waste .

you can send it for recycling into compost.

you can treat biodegradable waste on an industrial scale by either composting or anaerobic digestion.

composting is more suitable for fibrous materials.

anaerobic digestion is more suitable for wastes and sludgest that degrade easily.


which of the following is not irrational number?
(1)√2
(2)2/√6
(3)√36/1296
(4)-√6+6

Answers

Explanation:

hi !!

here i think all areirrational expect root 36/1296,

1. root 2= root 2= 1.414213562

2. 2/root 6= root 6 /3 = 0.8164965809

3. root 36/1296=1/6=1.66666667

4. - root 6+6= -2 root 3 = -3.464101615

so, they are extended and dont have exact value so all are irrational expect no. 3 because it can be expressed in 1/6 fraction form but others will come on root form.

Hope it helps...

Answer:

[tex]\frac{\sqrt{36} }{1296}[/tex]

Explanation:

[tex]\sf A \ rational \ number \ can \ be \ expressed \ as \ a \ quotient \ of \ two \ whole \ integers.[/tex]

[tex]\sqrt{2} = 1.41421356237...[/tex]

[tex]\frac{2}{\sqrt{6} } = 0.816497...[/tex]

[tex]\frac{\sqrt{36} }{1296} =\frac{6}{1296} =\frac{1}{216}[/tex]

[tex]-\sqrt{6} +6= 3.55051...[/tex]

[tex]\sf The \ rational \ number \ from \ the \ list \ is \ \frac{\sqrt{36} }{1296}[/tex]

1. The Hawaiian Islands are examples of islands that formed over a hotspot. Based on this information, which of the following processes formed the Hawaiian Islands? (2 points) Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled. Tectonic movement forced certain segments of Earth's crust downward and other segments upward in jagged chunks. One tectonic plate moved beneath another plate at a subduction zone, causing the rock to melt and rise above Earth's surface. Segments of Earth's crust bent and doubled over, and moving wind and water gradually shaped the rock into gently sloping domes.

Answers

Answer:

The correct answer is -  Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled.

Explanation:

The Hawaiian Islands are the chain of eight major islands situated in U.S. of Hawaii. These are formed over a hot spot. About 75 million years ago such hotspot took place in the center of the Pacific Plate.

There are hot spot due to the volconic activity and in the moving over the tectonic plate of a subduction zone. Volcanic activity and overriding of plates that cause rising magma by melting the moving down plates whice leads to volcanic arcs formation. The magma that rose gradually cooled down and become solid over the time. It is an example of a large seamount and island chain created by hot-spot volcanism.

Thus, The correct answer is - Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled.

Which of the following is found in the 'rungs' of a DNA strand?
A. Uracil
B. Thymine
C. Deoxy Ribose
D. Phosphate

Answers

Answer:

Thymine

Explanation:

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Other Questions
A small helium-neon laser emits red visible light with a power of 5.40 mW in a beam of diameter 2.30 mm.Required:a. What is the amplitude of the electric field of the light? Express your answer with the appropriate units.b. What is the amplitude of the magnetic field of the light?c. What is the average energy density associated with the electric field? Express your answer with the appropriate units.d. What is the average energy density associated with the magnetic field? Express your answer with the appropriate units.E) What is the total energy contained in a 1.00-m length of the beam? Express your answer with the appropriate units. Which of the following is the correct set notation for the set of perfect squares between 1 and 100 (including 1 and 100)?Select the correct answer below:{p2p and 1p10}{p2p and 1{p2p and 1p10}{p2p and 1 Is 3+(-4) the same as -4+3 ? Explain HELP PLEASE ASAP I REALLY DONT KNOW HOW TO DO THIS What is the slope of a line perpendicular to the line containing the points $(-1,2)$ and $(1,-2)$? Express your answer as a common fraction. Enter your answer If a cell has 24 pairs of chromosomes in its diploid state, how manychromosomes will it have after Meiosis 2?A. 12B. 24C.48D. 6 (Pls Help) The study of such concepts as motion, force,y energy, matter, heat, sound, light, and the components of atoms is:- Physics- Biology- Earth Science- Astronomy What is the solution to -5 + z = -12 A. z = -17 B. z = -7 C. z = 7 D. z = 17 please help which phrase best completes the diagram? Nine and one-half less than four and one-half times a number is greater than 62.5. Which of the following represents the solution set of this problem?(16, positive infinity)(Negative 16, positive infinity)(Negative infinity, 16)(Negative infinity, Negative 16) Two numbers are in ratio 3 by 2 and their difference is 5 find numbers whats a negative times a positive times a negative? Generally, statutes and the case law governing franchising tend to emphasize the importance of Select and fair dealing in franchise relationships. This requires that the parties act Select and in good faith in fulfilling their contractual duties. An octagonal pyramid ... how many faces does it have, how many vertices and how many edges? A triangular prism ... how many faces does it have, how many vertices and how many edges? a triangular pyramid ... how many faces does it have, how many vertices and how many edges? Burke's Corner currently sells blue jeans and T-shirts. Management is considering adding fleece tops to its inventory to provide a cooler weather option. The tops would sell for $53 each with expected sales of 4,300 tops annually. By adding the fleece tops, management feels the firm will sell an additional 285 pairs of jeans at $65 a pair and 420 fewer T-shirts at $26 each. The variable cost per unit is $36 on the jeans, $16 on the T-shirts, and $31 on the fleece tops. With the new item, the depreciation expense is $33,000 a year and the fixed costs are $76,000 annually. The tax rate is 35 percent. What is the project's operating cash flow? plz help asap i have limited time i will give brainliest What is the area of a parallelogram if the coordinates of its vertices are (0, -2), (3,2), (8,2), and (5, -2)? A soda bottling companys manufacturing process is calibrated so that 99% of bottles are filled to within specifications, while 1% is not within specification. Every hour, 12 random bottles are taken from the assembly line and tested. If 2 or more bottles in the sample are not within specification, the assembly line is shut down for recalibration. What is the probability that the assembly line will be shut down, given that it is actually calibrated correctly? Use Excel to find the probability. Round your answer to three decimal places. A portfolio to the right of the market portfolio on the CML is: Group of answer choices a lending portfolio. an inefficient portfolio. a borrowing portfolio. Find the midpoints of the points (-3,-2) and (1,-4) Question is on the picture. Answers: A. 0.1 J/g*C B. 0.2 J/g*C C. 0.4 J/g*C D. 4 J/g*C