When pure black hamsters were mated with pure white hamsters, all of the offspring were black. The trait for whiteness would best be described as?

Answers

Answer 1

Answer:

Recessive

Explanation:

All of the offsrping were black so that means black was the dominant gene and white was the recessive

Answer 2

At the time when the pure black hamsters were mated so here,  the whiteness trait should be called the recessive.

What is recessive?

It refers to the allele type that should not be manifested in an individual till both individual copies of the gene should include the particular genotype.

And, all the offspring should be considered as black so here black treated as the dominant gene and white should be considered as the recessive

Hence, the whiteness trait should be called recessive.

Learn more about trait here: https://brainly.com/question/18532463


Related Questions

In the mouse model of malaria, the researchers injected Plasmodium-infected human red blood cells into the mice because the Plasmodium species had surface ligand proteins that bound only to cell membrane proteins of human red blood cells. Assume that the researchers noticed that some of the parasites no longer infected human red blood cells but instead infected mouse red blood cells. Predict the most likely cause of this change in the host specificity of the parasites. Plasmodium reproduces both sexually in the host vertebrate and asexually in mosquitoes. The researchers claim that the Plasmodium organisms that infect the two different types of red blood cells are likely to evolve into two separate species of Plasmodium. Based on the biological species concept, provide reasoning that would support the researchers’ claim.

Answers

There is a mutation in the în the genes coding the ligand. They will evolv3 separately in two host species proving the researchers right.

What is the Florida state lizard (don’t search) just guess

Answers

Its uhm the iguana right?

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

The death of nearby cells and the presence or absence of certain hormones can impact the cell cycle

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

help.................

Answers

Answer:

I would say B.

de-forestation is definitely not the answer. and introducing non native species is usually a big no no for the ecosystem.

Answer:

b

Explanation:

if there is nothing to kill bees with then they wont die.

Deoxyribose (sugar). Total number in image?

Answers

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks

Answers

Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

Other Questions
100 POINTS! :)Please answer the question correctly WITH WORK...otherwise I will report! :)Joshua has a ladder that is 12.8 ft long. He wants to lean the ladder against a verticle wall so that the top of the ladder is 11 ft above ground. For safety reasons, he wants the angle of the ladder no greater than 75 degrees. Will the ladder be safe at this height? Show your work. My heart, your heartSit tight like bookendsPages between usWritten with no endSo many words we're not sayingDon't wanna wait 'til it's goneYou make me strongI'm sorry if I say, "I need you"But I don't care, I'm not scared of love'Cause when I'm not with you, I'm weakerIs that so wrong? Is it so wrongThat you make me strong?Think of how muchLove that's been wastedPeople alwaysTrying to escape itMove on to stop their heart breakingBut there's nothing I'm running fromYou make me strongI'm sorry if I say, "I need you"But I don't care, I'm not scared of love'Cause when I'm not with you, I'm weakerIs that so wrong? Is it so wrong? What is the equation for the nth term of geometric sequence 32,48,72 5?Find the arc length of the partial circle.Either enter an exact answer in terms of Tor use 3.14 for and enter your answer asdecimal.units Can any one answer everything PLEASE HELP!!Which of the following was an effect of westward expansion in North America? (Select four)Conflicts with Native AmericansFrench & Indian WarBattles of Lexington & ConcordProclamation Line of 1763Settlement of TennesseeBoston Massacre when was athens founded Point Z is the incenter of triangle RST. Point Z is the incenter of triangle S R T. Lines are drawn from the points of the triangle to point Z. Lines are drawn from point Z to the sides of the triangle to form right angles and line segments Z A, Z B, and Z C. Angle A S Z is (5 x minus 9) degrees and angle Z S B is 16 degrees. What is the value of x? x = 2 x = 3 12. A glass plate 1 cm thick, of refractive index 1.50, is placedbetween a point source of light of wave length 6000 and ascreen. The distance from the source to the screen is 4 cm.How many waves are there between the source and thescreen? Translate the following sentences into French.18. I would also like to take your temperature.19. I am prescribing a cough syrup.20. You should buy some tissues.PLEASE DONT USE THE TRANSLATOR Animal populations are not capable of unrestricted growth because of limited habitat and food supplies. Under such conditions the population follows a logistic growth model: P(t) = d 1 + kect where c, d, and k are positive constants. For a certain fish population in a small pond d = 1200, k = 11, c = 0.2, and t is measured in years. The fish were introduced into the pond at time t = 0. (a) How many fish were originally put in the pond? 100 Correct: Your answer is correct. fish (b) Find the population after 10, 20, and 30 years. (Round your answers to the nearest whole number.) 10 years 1 Changed: Your submitted answer was incorrect. Your current answer has not been submitted. fish 20 years fish 30 years fish (c) Evaluate P(t) for large values of t. What value does the population approach as t [infinity]? P(t) = The term industrialized means?A. Industries ina country on a large scale B. The flow of people moving from one place to another C. Believe in spirits of there ancestors ,air,earth, and river D. Most important or powerful 3. An airplane is flying at 10 km altitude in the standard atmosphere. The internal pressure of the aircraft interior is 100 kPa. Estimate the outward force on the window. The window is flat and has an elliptical shape with lengths of 300 mm along the major axis and 200 mm along the minor axis. In 1941, how did Axis powers gain control of most of Europe? An electric toy with a resistance of 2.50\,\Omega is operated by a 3.00\,\text{V} battery. (c) How much energy was delivered to the toy [over four hours]? Find the area of the shaded regionhelpp!! Explain what political system are whitch political group became increasingly popular in Germany after World War I Can someone help pls what is the sum of the fraction