Answer:
The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.
The cell membrane consists of two adjacent layers of phospholipids, which form a bilayer. The fatty acid tails of phospholipids face inside, away from water, whereas the phosphate heads face the outward aqueous side.
What is cell membrane?
The cell membrane is a biological membrane that separates and protects the interior of all cells from the outside environment.
Moreover, the cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
Hence, cellular membranes — including plasma membranes and internal membranes — are made of glycerophospholipids, molecules composed of glycerol, a phosphate group, and two fatty acid chains.
Learn more about cell membrane:
https://brainly.com/question/13524386
#SPJ2
according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to
Answer:
is going on is your answer
The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole
what is a good definition of photosynthesis?
A. using glucose to create light
B. putting together lights so we can see
C. using light to put together food (glucose)
Answer:
The best answer is C
Explanation:
Plants use light to create their own food. this is called photosynthesis
Answer:
C
Explanation:
The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.
SOMEONE HELP WILL GIVE BRAINLIEST ANSWER
Which of the following suggests what happens when a mutation occurs in an organism? Select one:
Genes begin to appear in different individuals of the population all at once.
The organism develops new traits as a result of using a particular body part.
New traits appear from changes in the instructions given to the cell by the DNA. Useless traits are removed from the organism due to the loss of nucleotides
Answer:
New traits appear from changes to the DNA..
Explanation:
A mutation is when DNA is changed or altered in some way, causing it to tell the cells to do something different from what they usually do such as growing a body part a certain way, or making skin regenerate a certain way. some mutations are specific to one individual person or thing, other mutations are passed down through generations and become a new normal for the species. new diseases such as viruses are often caused by the virus mutating...this is how we have so many different strains of the flu...
How to overcome Confusion?????
Answer:
use a full heal
Explanation:
How are the early stages of embryonic development different from the later stages of development?
2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula
Answer:
C. Pantasya
Explanation:
Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito
Sana nakatulong ito :)
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna
Answer:
Double Helical Spiral structure
Explanation:
DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.
It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.
Classify each of the samples in the grid below as one of the following substances. Each one may be used more than once:
si 0?no Nop suficientemente silvestre usuario independencia 6t?
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
Ivy grows specifically on stone walls, what type of response is this?
A. Hydrotropism
B. Thigmotropism
C. Phototropism
D. Geotropism
Answer:
B. Thigmotropism
Explanation:
Thigmotropism is a directional growth movement which occurs as a mechanosensory response to a touch stimulus. Thigmotropism is typically found in twining plants and tendrils, however plant biologists have also found thigmotropic responses in flowering plants and fungi.
Answer:
B. Thigmotropism
Explanation:
The ivy grows specifically on stone walls, it shows Thigmotropism.
How do I calculate Ph?
Explanation:
To calculate the pH of an aqueous solution you need to know the concentration of the hydronium ion in moles per liter (molarity). The pH is then calculated using the expression: pH = - log [H3O+].
Someone pls help me ill give out brainliest pls don’t answer if you don’t know
Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer
B. Decomposer
D. Producer
Answer:
B. Decomposer
Explanation:
Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.
if humans began hunting and driving the great barracuda to extinction how would this affect the ecosystem (answer should discuss biodiversity, food webs, and food chains)
Answer:
Generally considered to be the tertiary consumers (top level of the food pyrmaid), barracuda feed on an array of preys including grunts, groupers, snappers, small tunas, mullets, killifishes, herrings, and anchovies. By feeding on these marine organisms, barracuda prevent them from increasing in number.
Now let's barracuda's number starts decreasing due to hunting and other reasons. This will result in other primary and secondary consumers to increase in population. An increase in the number of primary and secondary consumers in the food chain will result in a decreasing number of plants, i.e. the number of producers decreases. Hence, this will negatively affect other connected food chains in the marine food web.
Explanation:
which scenario is an example of the transfer of thermal energy by conduction?
Answer:
heat causes winds to blow from the water to the land. Heated air molecules in a hot air balloon soon carried thermal energy to the top of the balloon. this is an example of conduction.
Explanation:
Have a nice day :)
What is the smallest LIVING part of an organism?
A. Molecules
B. Cells
Answer:
Hi, there the answer is a cell
Explanation:
The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.
Answer:
B. Cells
Explanation:
The cells are the smallest living part of an organism.
Te
а.
Which of the following is a way that scientific advancements have benefited society?
increased energy efficiency
Б. increased resource use
increased urbanization
d changes in the global climate
C.
Please select the best answer from the choices provided
Mark this and return
Save and Exit
Next
Submit
Answer:
Б. increased resource use
increased urbanization
Which of the following organelles is properly matched to it's function?
lysosome: storage
endoplasmic reticulum: movement
lysosome: digestion
chloroplast: making proteins
The organelle properly matched to it's function is
-(C) lysosome: digestion
Explanation:
Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies
Endoplasmic reticulum : to produce proteins for the rest of the cell to function.
Chloroplast : They are responsible to carry out photosynthesis
How many acres of land do you think were required for all forms of food except
beef?
A. 20,475 acres
B. 45,510 acres
C. 105,000 acres
D. 410,505 acres
EARTH SCIENCE CLASS
Why is the street (asphalt) hotter than the sidewalk in the summer ?
Answer:
bad albedo ? sorry if not right
what are alleles mutations in the dna
Answer:
Mutations Are Recessive or Dominant
A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia
Answer:
The correct option is 2 Nephrogenic diabetes insipidus.
Explanation:
Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.
As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.
Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.
Therefore, the correct option is 2 Nephrogenic diabetes insipidus.
That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
Cellular respiration is how living things obtain energy for life. The organelle where cellular respiration takes place is the
A. chloroplast
B. Golgi body
C. mitochondria
Answer:
C. Mitochondria
Explanation:
which process reduces the number of chromosomes by half
Answer:
Meiosis process reduces the number of chromosomes by half.
Explanation:
Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.
Answer:
meiosis
Explanation:
meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells
which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?
A organelle_cell_tissue_organ_organ system_oraganism
B cell_organelle_tissue_organ_organsystem organisms
C organelle_tissue_cell_organ_organ system organisms
D cell_organism _organ_organ system _tissue_organelle
Answer:
it's A
Explanation:
It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.
I hope it helps :))
Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.
Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.
Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase
Explanation: I got it right hopefully it helps
Answer:just did it
Explanation:
Photosynthesis in plants is an example of
Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.
Photosynthesis in plants is an example of nutrition
What is photosynthesis?
Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.
It is carried out by algae, plants and even some microorganisms.
The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.
Therefore, photosynthesis in plants is an example of nutrition
Learn more about photosynthesis here:
https://brainly.com/question/3529377
#SPJ9