When equipment malfunctions, a(n) _____ needs to be initiated.

A) Notification

B) Paper Work

C) Alarm

D) Work Order

Answers

Answer 1

Answer: Alarm

Explanation:

When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.

This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.


Related Questions

how did advancements in technology help scientists better understand process of cell division?

Answers

Answer:

As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.

Explanation:

Hoped I helped you out please mark me brainliest!!!

With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.

What is a microscope?

A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.

In most cases, the light is focused on the sample by passing it through a condenser.

After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.

The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.

Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.

For more details regarding microscope, visit:

https://brainly.com/question/18661784

#SPJ2

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

triangular shaped land mass found on land ​

Answers

Answer:

beautiful

Explanation:

serioudly I like it

Deltas are beautiful landforms, especially when viewed from above. Roughly triangular in shape, deltas are full of complex, wonderful detail: swirling, multi-colored sediments broken by serpentine, miniature river channels.

HELP QUICK HELP ILL MARK U BRAINLIST

Answers

Answer:

B or A I think B

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

**anatomy & physiology question**

if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?

Answers

Answer:

0.8mm.

Explanation:

If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.

Answers

It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.

What are the important factors for the experiment?

This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:

Acceleration: This factor is the one you will measure in your experiment.

Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.

Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.

Steps for the experiment:

Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.

Throw different objects with different masses: You can begin with light objects and move into heavier objects.

Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.

Learn more about acceleration in:

brainly.com/question/12134554

#SPJ1

To find new and alternative farming methods and practices, private companies often fund their own research and development teams.


False

True

Answers

I think the answer is false

:):):):):)

Answer:

FALSE ALL DAY LONG

Explanation:

1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?​

Answers

Answer: 1. The nitrogen cycle is a biogeochemical cycle.

2. The carbon cycle is a biogeochemical cycle.

Explanation:

1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.

2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.

Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem


WILL GIVE BRAINLIEST

Answers

1 population
2 species
3 economists
4 biome
5 biosphere

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

Provide at least 1 example of a mutation
that does not have a negative effect on
the individual.
PLEASE HELP ME

Answers

i honestly don’t know but i’m guessing maybe having more fingers or something

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

I really need help on this cause i read the assignment and they didn't explain it well. :(

Answers

Explanation:

Sir kindly take a clearer shot it the questions for assistance

uses of crush in the farm​

Answers

Answer:

ok i dont understand what that is

Explanation:

Answer: The overall purpose of a crush is to hold an animal still to minimise the risk of injury to both the animal and the operator while work on the animal is performed.

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference

Answers

Answer:

The coefficient of interference, I, is 0.1 (10% expressed as a percent)

Explanation:

Available data:

genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.

The coefficient of interference, I, is complementary with CC.

I = 1 - CC

To calculate the coefficient of coincidence, CC, we must use the next formula:

CC= observed double recombinant frequency/expected double recombinant frequency    

Note:  

observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.

By knowing the positions of genes, we can estimate the distances in MU between them per region.

The  distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MU

Now that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.

recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06

Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:

EDRF = recombination frequency in region I x recombination frequency in region II.

EDRF = 0.13 x 0.06 = 0.0078

Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:

ODRF = number of double crossovers / total number of individuals

ODRF = 7/1000 = 0.007

Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.

CC = ODRF/EDRF

CC =  0.007 / 0.0078

CC = 0.9

And by knowing the CC we can also get the coefficient of interference, I.

I = 1 - CC

I = 1 - 0.9

I = 0.1 = 10% (expressed as a percent)

What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences​

Answers

Answer:

A

Explanation:

I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.

Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.

Answers

Answer: Its A my friend, how it helps!.

Explanation: I just completed the Test.

The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.

What do you mean by adaptation?

In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.

The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.

Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.

Learn more about adaptation:

https://brainly.com/question/12534888

#SPJ2

Giving points and brainliest to the first person

Answers

i am uwu


!!!!!!!!! mememememmemememmeme

Feeding problems may develop during the preschool years partially because of:_______

a. decreased appetite associated with decreased growth rate.
b. increased appetite associated with increased growth rate.
c. increased metabolic rate.
d. increased need for finger foods.

Answers

Answer:

The correct option is A.

decreased appetite associated with decreased growth rate

Explanation:

Feeding problems may develop in preschool age because of decreased appetite associated with decreased growth rate and this is because at the preschool age, there is no rapid growth, the growth rate is reduced which is as a result of decreased appetite for food. We all know that food supply the body with energy and necessary nutrients for growth. When there is decreased appetite enough food needed for growth will not be consumed , hence decrease growth rate.

What is seed dispersal? Name some agents of seed dispersal​

Answers

Answer:

The Process by which seeds spread over a wide area is known as seed dispersal..

some agents

Air

water

animals

etc..

Answer:

Seed dispersal is the movement, spread or transport of seeds away from the parent plant.

The most common methods are :

wind, water, animals, explosion and fire.

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

please help with this question​

Answers

Answer:

a -5

d -2

c-3

b-4

e - 5

Explanation:

I'm guessing this is the answer

Other Questions
The Amazon River greatly impacts the environment of South America because...A it regularly dries up and forces the people to move to the cities to work for food.B it regularly floods forcing the people to move to the city for better housing.C it is the home of very few plants and animals and the people are not able to live off of the land.D it is the home of many different plants and animals that the people are able to use for food and medicine. for every 6 white roses, there are 8 pink roses. If the floral arrangement is proportional then how many pink roses are in a arrangement with 10 white roses what are you doing today? Solve -1/2 + (3/4 x 4/9) = ? I need help someone pls help me What are P waves and S waves? How are they recored? 1. Only some prepositions have objects. True False2.A preposition creates a relationship between its object and another word in the sentence. True False WHATS 10/7 divided by 4 3 There are 5 times as many boys as girls in a school.Together the school has 810 pupils.How many boys are there? Can someone answer these 2 questions for me? Two sets are shown in the Venn diagram. Set N represents the natural numbers, and Set W represents the wholenumbers. in which set does the values -45 belong? What is the function of Primase? please help. ill give brainiest 5. What countries were permanently part of the Axis Powers? Which of the following is a benefit of natural borders?World geo Pic What does his reaction indicate about his feelings for Mercutio and himself? Feeding problems may develop during the preschool years partially because of:_______a. decreased appetite associated with decreased growth rate. b. increased appetite associated with increased growth rate. c. increased metabolic rate. d. increased need for finger foods. Which statements about experimental probability are true? O Experimental probability is written as a ratio. O Experimental probability includes the number of possible outcomes. O Experimental probability is found by conducting trials of an experiment. O Experimental probability includes the number of times an event occurs in the numerator, and the total number of trials in the denominator. O Experimental probability includes the number of times an event occurs in the denominator, and the total number of trials in the numerator. 5+2x+6=x +10 Solve this equation and show ur work This quote is a call for American Indianresistance.removal.assimilation.