What's the definition of absoulute dating

Answers

Answer 1

Absolute dating is the process of determining an age on a specified time scale in archaeology and geology. Some scientists prefer the terms chronometric or calendar dating, as use of the word "absolute" implies an unwarranted certainty and precision. Absolute dating provides a numerical age or range in contrast with relative dating which places events in order without any measure of the age between events. In archeology, absolute dating is usually based on the physical, chemical, and life properties of the materials of artifacts, buildings, or other items that have been modified by humans and by historical associations with materials with known dates. Techniques include tree rings in timbers, radiocarbon dating of wood or bones, and trapped charge dating methods such as thermoluminescence dating of glazed ceramics. Coins found in excavations may have their production date written on them, or their may be written records describing the coin and when it was used, allowing the site to be associated with a particular calendar year.


Related Questions

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

What are chromosomes? How are they different between prokaryotes and eukaryotes?

Answers

Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not

Explanation:

Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.

Chromosome:

It is a long thread of DNA molecule as a part of genetic material of all living organisms.

In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.

In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.

   

Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.

To know more about Chromosomes,

https://brainly.com/question/296477

1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?​

Answers

Answer: 1. The nitrogen cycle is a biogeochemical cycle.

2. The carbon cycle is a biogeochemical cycle.

Explanation:

1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.

2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.

Answer quickly please

How do roundworms differ from earthworms?

A. They have a cylindrical body.

B. They have a body that is tapered at both ends.

C. They reproduce sexually.

D. They are not divided into segments.

Answers

Answer:

Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.

Explanation:

So: A?

Answer:

A

Explanation:

They have a cylindrical body.

Have a great day and good luck

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

Giving points and brainliest to the first person

Answers

i am uwu


!!!!!!!!! mememememmemememmeme

PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.

Answers

It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.

What are the important factors for the experiment?

This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:

Acceleration: This factor is the one you will measure in your experiment.

Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.

Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.

Steps for the experiment:

Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.

Throw different objects with different masses: You can begin with light objects and move into heavier objects.

Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.

Learn more about acceleration in:

brainly.com/question/12134554

#SPJ1

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

HELP QUICK HELP ILL MARK U BRAINLIST

Answers

Answer:

B or A I think B

How can the arrangement of atoms help explain how the white phosphorus and red phosphorus can both be pure phosphorus substances?

Answers

Answer:Phosphorus is a chemical element with symbol P and atomic number 15. A multivalent nonmetal of the nitrogen group, phosphorus as a mineral is almost always present in its maximally oxidized state, as inorganic phosphate.

Explanation:

Chemical element phosphorus has the atomic number 15 and the letter P in its symbol. Phosphorus, a multivalent nonmetal belonging to the nitrogen group, is generally always found in the form of inorganic phosphate, which is phosphorus in its maximally oxidized state.

What is phosphorus?

The mineral phosphorus, which is also available as a supplement, is naturally present in many foods. It serves the body in a multitude of capacities. It is a crucial component of cell membranes, bone, and teeth. It maintains a healthy range of blood pH and aids in the activation of enzymes.

All tissues and cells must have phosphorus for growth, maintenance, and repair as well as for the creation of DNA and RNA, the genetic building blocks. The balance and usage of other vitamins and minerals, including vitamin D, iodine, magnesium, and zinc, depend on phosphorus as well.

Thus, Chemical element phosphorus has the atomic number 15.

For more information about phosphorus, click here:

https://brainly.com/question/4622631

#SPJ2

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

To find new and alternative farming methods and practices, private companies often fund their own research and development teams.


False

True

Answers

I think the answer is false

:):):):):)

Answer:

FALSE ALL DAY LONG

Explanation:

The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this happened

Answers

Explanation:

Maybe this can help.

In bread making (or special yeasted cakes), the yeast organisms expel carbon dioxide as they feed off of sugars. As the dough rises and proofs, carbon dioxide is formed; this is why the dough volume increases.

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference

Answers

Answer:

The coefficient of interference, I, is 0.1 (10% expressed as a percent)

Explanation:

Available data:

genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.

The coefficient of interference, I, is complementary with CC.

I = 1 - CC

To calculate the coefficient of coincidence, CC, we must use the next formula:

CC= observed double recombinant frequency/expected double recombinant frequency    

Note:  

observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.

By knowing the positions of genes, we can estimate the distances in MU between them per region.

The  distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MU

Now that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.

recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06

Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:

EDRF = recombination frequency in region I x recombination frequency in region II.

EDRF = 0.13 x 0.06 = 0.0078

Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:

ODRF = number of double crossovers / total number of individuals

ODRF = 7/1000 = 0.007

Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.

CC = ODRF/EDRF

CC =  0.007 / 0.0078

CC = 0.9

And by knowing the CC we can also get the coefficient of interference, I.

I = 1 - CC

I = 1 - 0.9

I = 0.1 = 10% (expressed as a percent)

What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences​

Answers

Answer:

A

Explanation:

I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

When does gamete production occur?

Answers

Gametes are formed through meiosis, in which a germ cell undergoes two fissions, resulting in the production of four gametes. During fertilization, male and female gametes fuse, producing diploid

please help with this question​

Answers

Answer:

a -5

d -2

c-3

b-4

e - 5

Explanation:

I'm guessing this is the answer

A farmer has been trying to increase his crop yield for the last 10 years by
adding about 25% more fertilizer to his crops than he needs. What will most
likely result from this action?
Select one:
a. Increased crop yields.
b. Air pollution from the excess fertilizers
c. Soil degradation form the excess fertilizers
d. The additional fertilizer will have little to no impact.

Answers

Answer:

The correct answer is - b. Air pollution from the excess fertilizers

Explanation:

In long term using excess amount of fertilizer than requirement will lead to several condition such a soil acidity, soil degradation, soil leacing, eutrophication of waterways and many but more improtant is green house gases and air pollution.

Using the excess amount of fertilizer does not help in increasing crop yield but gives negative impact. Using fertilizer more than requirement wil lead to release of toxic and harmful gases in atomosphere and fuming.

Feeding problems may develop during the preschool years partially because of:_______

a. decreased appetite associated with decreased growth rate.
b. increased appetite associated with increased growth rate.
c. increased metabolic rate.
d. increased need for finger foods.

Answers

Answer:

The correct option is A.

decreased appetite associated with decreased growth rate

Explanation:

Feeding problems may develop in preschool age because of decreased appetite associated with decreased growth rate and this is because at the preschool age, there is no rapid growth, the growth rate is reduced which is as a result of decreased appetite for food. We all know that food supply the body with energy and necessary nutrients for growth. When there is decreased appetite enough food needed for growth will not be consumed , hence decrease growth rate.

Classical biotechnology begins around 1800,
O True
False

Answers

Answer:

True

Explanation:

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

**anatomy & physiology question**

if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?

Answers

Answer:

0.8mm.

Explanation:

If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.

Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.

Answers

Process of elimination is helpful for this question.

You can already remove B, and D, because if you were to be taking these classes, you would know that blood obviously has red blood cells in it, and it is rich in oxygen.

This leads into the answer:
of A, which is the correct answer of “It is oxygen rich.”

C is a no contest answer because blood in the arteries actually moved away from the heart, not towards it.

Hope this helps :)))

It is oxygen rich

What do you mean by arteries?

The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.

What is oxygenated blood?

Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.

To learn more about arteries here

https://brainly.com/question/3306673

#SPJ2

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

Other Questions
A g drought ravaged crops across the United States during the summer of 2012. What is the likely impact of this drought on the price of corn Cmo se llama el baile de la Repblica Dominicana? Which expressions are in their simplest form? Check all that apply. HELP THIS IS DUE TODAY A teacher surveys a sample of students from lake middle school. He asks the students where theyd like to go for a field trip. He records the results:80 choose the aquarium 60 choose the science center30 choose the planetarium 40 choose the farm2. What is the relative frequency of a student choosing the aquarium? Give your answer as a decimal rounded to the nearest hundredth. Please help me I need help number three 17 points for all work shown. Why are seminal works valuable for modern readers? Choose the best answer.They challenge us to read at a higher levelThey make us appreciate advances in cultureThey show us the history of the ideas and issues of todayThey help us grow Who is Sal and how has he helped Jeremy so far in the dream bender PLEASE ANSWER ASSAP!!!!!!!!!!!!!!!! WILL GIVE BRAINLEST!!!!!!!!!!!!!!!!!!! YALL PLS HELP ME! CAN YOU GUYS CHECK MY ANSWERS? please hellp!!!!!!!!!!!!!!!!!!!!? And his father, who was puro Mexicano, would sit in his chair after work, sullen as a toad, and call him "sissy."The phrase sullen as a toad is an example of a. A sample of n = 4 scores has SS = 48. What is the estimated standard error for this sample? Group of answer choices Identify The coefficients and constants of the expression 6n+8 What are the answers to the last two questions? Ito ay binubuo Ng MGA note at rest a pinagsama Sama saloon Ng measure Fill in the table to show a proportional relationship and then identify the constant of proportionality for the cost to the number of yoga classes. In the answer box, please list the constant of proportionality which texas leader was most reasbonsible with this headline Why is it a misnomer (a wrong or inaccurate name or designation) to call Jefferson a "man of the people?" can someone plz help me with this.. brainliest for whoever can translate this Latin sentence.Nuntii spectaculum nuntiabant.Pompeiani nuntios audiebant.