What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Answer 1

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA


Related Questions

Winter wheat is planted in the early autumn, grows over the winter when the weather
is colder, and is harvested in the spring. As the temperature drops, the composition of
the cell membrane of winter wheat changes. Unsaturated fatty acids replace saturated
fatty acids in the phospholipids of the membrane. Why is this a suitable adaptation?

Answers

Answer: It is the cell membrane will change and unsaturated fatty acids replace saturated.

Explanation:

Because unsaturated fatty acids have a kink, substituting unsaturated fatty acids for saturated fatty acids in the cell membrane of winter wheat is a suitable adaptation for the increased fluidity present in Option A.

What are unsaturated fatty acids?

Cell membranes are composed of a lipid bilayer, which is made up of two layers of phospholipid molecules and consists of lipids such as saturated and unsaturated fatty acids that differ in their chemical structure, Saturated fatty acids have no double bonds between the carbon atoms in their hydrocarbon chains, while unsaturated fatty acids have one or more double bonds that provide fluidity to the plasma membrane.

 

Hence, substituting unsaturated fatty acids for saturated fatty acids in the cell membrane of winter wheat is a suitable adaptation for the increased fluidity present in Option A.

Learn more about unsaturated fatty acids here.

https://brainly.com/question/28964372

#SPJ2

The question is incomplete, complete question is below

Winter wheat is planted in the early autumn, grows over the winter when the weather

is colder, and is harvested in the spring. As the temperature drops, the composition of

the cell membrane of winter wheat changes. Unsaturated fatty acids replace saturated      

fatty acids in the phospholipids of the membrane. Why is this a suitable adaptation?

A)increased fluidity

B)decreased fluidity

C)not increased fluidity

Is this statement true or false? Celia loves to download music from an illegal website. She uses the music in her documentary about saving the environment. She is behaving responsibly. true false
PLEASE HELP,
shadow lolbit

Answers

Answer:

False

Explanation:

It is not a responsible approach to getting the music you want by illegally downloading it.

Answer:

False

She is not behaving responsibly

Look at the photo. Explain how it shows both an individual and a community.

Answers

Answer:

The individual would be the caribou.  The community would be all the interacting groups of species in the same location

Hope this helps!

According to the picture given below, the Caribou is an individual that is living in a particular geographical location, while all other groups of individuals belonging to different species in that area represent a community.

What is Community?

A Community may be defined as a group of individuals belonging to different species living in the same area at a given time.

The individual is the unit of the population, while the population is the unit of evolution. This form of evolution is significantly required in order to construct a community where the different groups of individuals of different species are gathered in such a way that one depends on another.

Therefore, according to the picture given below, the Caribou is an individual that is living in a particular geographical location, while all other groups of individuals belonging to different species in that area represent a community.

To learn more about Community, refer to the link:

https://brainly.com/question/25939248

#SPJ2

Red blood cells are classifed as type A or type B, based on their surface antigens. Type O
blood does not contain any antigens. The chart below shows the possible phenotypes of
each blood type.
Blood Types
Blood Type Phenotype Alleles
B:
AB
B
AB
Which mechanism explains how both A and B antigens produce type AB blood?

Answers

Answer:

codominance

Explanation:

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

what is antigen?

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.

Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

Learn more about the antigen here

https://brainly.com/question/30587809

#SPJ2

A good example of a natural phenomena causing geographical isolation is the
-Mississippi River
-Sahara Desert
-Grand Canyon
-Great Pyramid​

Answers

Answer:A

Explanation:because

Which statements about plant and animal cells is true?
Group of answer choices

Plant cells have a cell wall and chloroplasts; animal cells do not have either.

Plant cells have a nucleus and a cell wall; animal cells do not have either of these.

Plant cells have a chloroplasts and mitochondria; animal cells have chloroplasts but do not have mitochondria.

Plant cells have a cell wall and a cell membrane; animal cells have a cell wall but do not have a cell membrane.

Answers

Plants have a cell wall and chloroplasts; animal cells do not have either

Hope this helps : )

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

Which is the best description of the cause of sound waves? *

Answers

Answer:Sound waves are caused by the vibration of the oceans floor like a underwater volcano causes the water to vibrate

Explanation:

10. How does a right angle (90°) alignment between Earth, the Sun, and the Moon influence the tides on Earth?
a. It produces the greatest change in high and low tides.
b. It produces the least change in high and low tides.
c. It produces semidiurnal tides.
d. It produces diurnal tides.

Answers

Answer: The combined gravitational pull of the Sun and moon cause high tides in the path of the alignment, meaning that low tides occur at ninety degrees from the path of the solar eclipse. Due to inertia, the high tides also occur on the opposite side of the Earth from the solar eclipse.

Explanation: it's a

Making change
Ideas of how we could use food to help serve health needs?

Answers

Answer:

to losee weight l m f a o

Explanation:

Without food we wouldn't survive. Can drives or some food donation will be a good start.

there are the same number of these two particules in an atom? What is it

Answers

protons and electrons if im not mistaken. They always have the same number in an atom.
Protons and electrons.

During the process of photosynthesis, energy from the Sun is converted into A) chemical energy in the bonds of inorganic molecules B) chemical energy in the bonds of organic molecules like glucose C) enzymes used to produce inorganic molecules D) enzymes used to produce organic molecules

Answers

Answer:

b

Explanation:

Photosynthesis is the process of preparing food in the presence of sunlight, water, and carbon dioxide to yield sugar and oxygen.

The correct option is:

Option B. chemical energy in the bonds of organic molecules like glucose

The process of photosynthesis involves:

Photosynthesis is carried out by plants. The leaves are the primary site for photosynthesis. The chloroplasts present in the plant cells are primarily involved in photosynthesis.

Photosynthesis involves the capturing of light energy and storing it in the form of bonds of organic molecules like glucose and starch.

The process involves carbon dioxide, water, sunlight, and green pigment chlorophyll to carry out photosynthesis. The products of the process are oxygen and sugar molecules holding the energy.

Thus, the correct answer is option B.

To know more about photosynthesis, refer to the following link:

https://brainly.com/question/1388366

Why do genes in eukaryotic cells have introns?

Answers

Answer:

Introns are crucial because the protein repertoire or variety is greatly enhanced by alternative splicing in which introns take partly important roles. Alternative splicing is a controlled molecular mechanism producing multiple variant proteins from a single gene in a eukaryotic cell.

Explanation:

RNA interference (RNAI) is a mechanism of gene regulation in eukaryotes. RNAI is initiated by ____, which leads to the ____ of specific genes.
Box 1:
single-stranded RNA
double-stranded RNA
double-stranded DNA
Box 2:
silencing
induction
expression

Answers

Answer:

double-stranded RNA;  silencing

Explanation:

The RNAi mechanism is a natural process of gene silencing triggered by different small non-coding RNAs such as, for example, siRNAs, miRNAs and piRNAs. RNAi is a powerful technique to induce gene silencing in a sequence-specific manner. The delivery of exogenous double-stranded RNAs (dsRNAs) can be used to induce this evolutionarily conserved mechanism.  The dsRNAs first bind to RNAi core components (Ago, Piwi proteins) and then target complementary mRNAs to induce their degradation.

Answer this pls!!!!!!!!!!!!

Answers

Answer:

sea anenome

Explanation:

It is sea anenomes because they provide shelter for sea creatures and they vary between hard and spft bodies

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

Which important event is happening?

Answers

Answer:

I believe the correct answer is option A.

Explanation:

have a good one.

And have a great winter break.

: )

( don't be shy, tap the little crown. o>o )

a regular solid has dimensions of 3.20 cm by 4.90 cm by 5.40 cm. the mass of the solid is 235g. what is its density in g/cm3​

Answers

Answer:

2.775415722

Explanation:

density is Mass divided by volume

PLS HURRY
Which organization informs hospitals, clinics, and other health care settings
about new asepsis techniques?
A. World Health Organization
B. Centers for Disease Control and Prevention
C. U.S. Department of Health and Human Services
D. Occupational Safety and Health Administration

Answers

Answer: It's Centers for Disease Control and Prevention

Explanation:

After watching the video describe a situation where an object would have potential energy transformed into knetic energy

Answers

Answer:

p

Explanation:

Mitosis occurs in living things when a cell divides to produce two cells. Compared to the original cell, how many chromosomes are in each of the resulting cells?
A.The same number
B.Twice as many
C.Half as many
D.An unpredictable number

Answers

A

Explanation:

After mitosis, two identical cells are produced with the same original number of chromosomes of the parent's cell. In this case, if a cell has 24 chromosomes, each daughter cell will have 24 chromosomes after mitosis

Do proteins build tissue

Answers

Answer:

Explanation:

Proteins are required for tissue to grow and repair themselves

Answer:

Yep

Explanation:

Without them, it would be impossible to build, repair or even maintain muscle tissue.

Fill in the blank:

Word Bank:

Cyclins, Inactivation, Skin, Cancer, Chromatids, Nerve

In multicellular organisms, cell growth and division is very controlled. Some cells like muscle and _______ cells stop dividing after maturity. Other cells like ______ and blood cells grow and divide rapidly through life. _______ are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to ______.

Answers

Nerve, Skin, Cyclins, Cancer

The growth and development of an organism are dependent on the control and coordinated activities of the cells, tissues, and organs.

The correct blanks for the given paragraph are:

In multicellular organisms, cell growth and division are very controlled. Some cells like muscle and nerve cells stop dividing after maturity. Other cells like Skin and blood cells grow and divide rapidly through life. Cyclins are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to cancer.

The statements can be explained as:

The muscle and nerve cells stop dividing after maturity. The nerve cells lack centrioles, which play a crucial role in the division of cells. Thus, the nerve and muscle cells do not divide.

The skin and blood cells divide continuously and throughout life. The cells when are damaged or dead, these cells replace them.

Cyclins are the proteins, which regulate and activate the cell cycle by binding with the cyclin-dependent kinases.

Cancer is repetitive and uncontrolled cell growth. It can be caused due to failure of regulation of cell cycle or any carcinogen exposure.

Therefore, the correct answers are nerve, skin, cyclin, and cancer.

To know more about cell division, refer to the following link:

https://brainly.com/question/19644932

Two characteristics of most plants are a root system and a shoot system. Most of the structures in these systems are common to all plants; however, there are some variations. Which structure can sometimes be found as part of the shoot system? Stems leaves roots flowers

Answers

Answer:

stems, leaves, flowers

Explanation:

There are two parts in the plants  ----

1. the shoot system

2. the root system

Shoot system are defines as the upper part of the plant which means it is the part that lies above the ground or surface. It consists of stem, leaves and flowers. It is responsible for food production and is the production center of a plant.

The root system is the part that is under the soil. It holds the plant in its place and helps to absorb water and mineral from the soil. It helps to store the products of the photosynthesis process from the shoot system.


5. Name 3 things bacteria are "notorious" for?

Answers

Answer:

While pathogenic bacteria are notorious for such diseases as cholera, tuberculosis, and gonorrhea, such disease-causing species are a comparatively tiny fraction of the bacteria as a whole. Bacteria are so widespread that it is possible only to make the most general statements about their life history and ecology.

Explanation:

hope this helps.

any other questions ask me.

You rush through your lab activity and obtain a percent error of 50 percent. Why might your percent error be so high?

Answers

Explanation: Can you be more specific with that plz?

HELP ME SOMEONE PLSss

Answers

Answer:

I think it's a or D I'm not sure

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity
Other Questions
i genuinely don't understand . please help me asap how did the different reasons for colonization lead to different levels of governmental presence in the colonies In a food web, where should all organisms have the arrows pointing to? Multiple choice question: (Consumers, producers, decomposers) What did the colonist trade for slaves? I am solely here to brag!I am officially a college student and only 14!Next semester I will on top of my high school classes be taking college courses.And by 11th grade be officially done with high school! The uterus is prepared to receive a fertilized egg. If the egg isfertilized after ovulation, it is implanted in the uterus and embryonicdevelopment begins. If it is not fertilized, it is shed along with the lining ofthe uterus. This shedding process during the cycle is called Spanish essayYou are corresponding with the foreign exchange student your family is hosting soon and youwant to get to know him or her before the arrival, so you are sending a welcome package thatincludes a letter. In this letter, you are explaining your (pre-virus) school life and the variousactivities you do in a normal school day and why. Ask them what various activities they enjoyand make them feel welcome in the United States. A two-by-four piece of wood is 1 1/2 inches wide. If placed side-by-side, how many boards are needed to make a width of 48 inches? Please help with this thank you :) what you do is inference WHATS going on without using burning, mouth, or hot chocolate and for the second one is to say whats going on without using slipping or ice What is the volume of 50.0 g of table sugar if the density of the sugar is 1.59 gcm3 ? is this proportional relationship? please help!! The Great Depression caused a split between Democrats and Republicans; what did they disagree about? The Trans-Saharan Trade Route connected West Africa to Europe and the Arab world. Why was this trade route important? Think about what was traded and what ideas spread. An adult ticket for hypnotist's show cost $15. A children's ticket for the hypnotist's show cost $9. The number of adult tickets sold 5 more times the number of children's ticket sold. A total of $1512 is taken in for ticket sales. How many of each type of ticket is sold.1. 21 adult tickets and 110 children's tickets2. 110 adult tickets and 22 children's tickets3. 10 adult tickets and 90 children's tickets4. 10 adult tickets and 18 children's tickets Read the information in the brainstorming table.Beginning: First, I signed up to audition for a part in the school play. Middle: Then I recited my lines and sang a short solo for the chorus teacher. End: Blank.Which piece of information best completes the table?A. Every year, the students in our school put on a spring performance.B. Finally, the chorus teacher announced there would be a school play.C. Then I chose a song and prepared for my audition.D. Finally, I was selected for a leading role in the play. 3)What is the epiglottis? 4)Why do the walls of the stomach secrete hydrochloric acid?5)Which TWO parts of the alimentary canal make up the small intestine? What type of sentence is this sentence? We can only speak of people Whose roots in America are older or newer.a. simpleb. compoundc. complexd. compound-complex Which equation is not linear A. -4x + 2y =7 B. x/4 =y C. X=-5 D. 2/x + 3/y [ that's / not a division it's a fraction bar] A teacher has 600 counters. He keeps 96 counters at his desk and gives the rest to 3 groups of students. The first group of students gets twice as many counters as the second group of students. The third group of students gets four times as many counters as the second group. How many counters did the second group get? What 3 powers do the National government have