What transmission pattern would indicate that a trait may be transmitted through X-linked inheritance

Answers

Answer 1

Answer:

The transfer pattern of an X-linked inheritance can be either X-linked dominant or X-linked recessive.

Explanation:

X-linked inheritance is the term that refers to a gene capable of causing a specific characteristic or disorder and is located on the X chromosome. During the transmission of genetic material for the formation of another living being, this gene can be transmitted through the transmission standards known as X-linked dominant or X-linked recessive.

X-linked dominance inheritance occurs when the dominant gene is transmitted on the X chromosome, while X-linked recessive inheritance occurs when the recessive gene is carried on the X chromosome.


Related Questions

State three ways of increasing the life-span of cut flowers​

Answers

Answer:

Clean your vase thoroughly, Keep flowers away from fruit, Flower Food and Water

Explanation:

14.
(GT.03)
Which of these best matches a source of information with its most reliable use? (2 points)


cladogram → date events which occurred in Earth's past

cladogram → study the evolution of organisms based on adaptations

fossil records → compare the evolution of completely soft-bodied organisms

fossil records → study the behavior of primitive animals in extreme weather conditions

Answers

Answer:

petrified fossils → date sedimentary rocks

Help me out with this again, pretty please?

(2nd time)

I need explanation for your answers, even though it's multiple choices, I still need your explanation for it.

DUE TOMORROW!

If your answer is NONSENSE it will be deleted as soon as possible!

But if your answer is CORRECT, HELPFUL, HAS AN EXPLANATION, I'll chose your answer as the BRAINLIEST ANSWER!​

Answers

Answer:

A. atomic number ✅A. groups ✅

Hope this helps!!

What is the purpose of a geological time scale ?

It used to predict natural disaters throughout Earth’s history.
It is used to present the correct sequence of events in the Earth’s history.
It is used to determine the absolute dates in years for different periods.
It used to create a naming system for flora and fauna.

Answers

Answer: B. It is used to present the correct sequence of events in the Earth’s history.

Explanation: On Edge!!!! :)

Answer:bbbbb

Explanation:

qcw3ec

What fraction of the progeny of the cross BbTt x BbTt will have black fur and long tails?

A) 0/16

B) 1/16

C) 3/16

D) 9/16

E) 16/16

Answers

Answer:

plzzzz upload a full picture

What is the term that refers to a deep divide between tissues of the brain?
Gyrus
fissure
sulcus
fusior

Answers

Answer:

fissure!

Explanation:

The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of

Answers

Answer:

The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of melatonin.

Explanation:

Melatonin is a hormone produced naturally by the body. Its function is to regulate the body's circadian cycle. This hormone is stimulated and begins to act by changing between a light environment and a dark environment. This stimulation interacts with the suprachiasmatic nuclei making the nervous system understand this change and luminosity of the environment and respond to the action of melatonin.

If a diploid cell has 20 chromosomes, how many sister chromatids will be present
during PROPHASE of MITOSIS?

Answers

Answer:

92 chromatids

Explanation:

During phosphate, the nuclear envelope of the cell (which is where the 92 chromatids are contained) begins to break down. The centrioles, which are the only present in animal cells, separate and each moves to an opposite end of the cell

What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.

Answers

Answer:

Cultivate prime grain and with timely care

The extinction vortex represents the idea that even if an organism is extant, it may have a gene pool that will not support its long-term survival.A. TrueB. False

Answers

Answer:

True.

Explanation:

Extinction vortex is a model used by scientists to understand extinction dynamics within a community. This model allows scientists to assess and understand how a population can become highly vulnerable to elements of its habitat, becoming increasingly apt for extinction. According to this model, any organism is capable of extinction, as all are susceptible to having a gene pool that will not allow its survival, regardless of the environment.

Which quantity does a light year measure

Answers

Answer:

distance = 9.46 trillion kilometers

Explanation:

Light years measure distance and is a unit that equals the distance light travels through space in one year on Earth (365 days) and is used as way to measure extremely vast distances in outer space. It equals 9.46 trillion kilometers.

The following statement is incorrect as stated "Pesticides create pesticide resistance in mosquitoes." Rewrite this sentence so that it is a more accurate statement of what actually occurs when pesticides are used. Why is this concept important to know in trying to control outbreaks of mosquito transmitted diseases such as eastern equine encephalitis (also known as Triple E)?

Answers

Answer:

Mosquitoes usually become resistant to pyrethroids through the mutation of a sodium channel gene that controls the movement of ions across cell membranes. Mutations in a single gene are enough to make mosquitoes almost completely resistant to the level of pyrethroids used in insecticides.

At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas reaches his right and left lungs, through which order of structures will it flow?
A. Oral cavity to the oropharynx to the trachea to the right and left main bronchi.
B. Oral cavity to the trachea to the trachea to the nasopharynx to the right and left main bronchi.
C. Oral cavity to the right and left main bronchi to the trachea to the oropharynx.
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
E. Oral cavity to the nasopharynx to the trachea to the right and left main bronchi.

Answers

Answer:

D. Oral cavity to the trachea to the larynx to the right and left main bronchi.

Explanation:

The respiratory system may be a system consisting of specific organs and structures used for gas exchange in animals and plants.

What is the process of respiration?

We have a pair of external nostrils opening out above the upper lips. It results in a nasal chamber through the nasal passage. The nasal chamber opens into the pharynx, some of which are the common passage for food and air. The pharynx opens through the larynx region into the trachea.Trachea is a straight tube extending up to the mid-thoracic cavity, which divides at the extent of the 5th thoracic vertebra into a right and left primary bronchi. Each terminal bronchiole gives rise to a variety of very thin, irregular-walled, and vascularized bag-like structures called alveoli. The branching network of bronchi, bronchioles, and alveoli comprise the lung.

Thus, we can conclude that the correct option is (e).

The oral cavity to the nasopharynx to the trachea to the right and left main bronchi.

You can learn more about the respiratory system here:

https://brainly.com/question/2619922

#SPJ2

How does water relate to the ability of a living thing to generate usuable energy?

Answers

Answer:

Without the proper balance of water, chemical reactions in cells could not take place.

Explanation: :)

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Answers

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above

Answers

Answer:

Only A

Explanation:

RNA is used for storing and transporting information through mostly virus only..

who do study edexcell certificate level? and can help be physics,chemistry and biology exam​

Answers

I have done GCSE sciences and also applied science a level so I could probably help you :)

Given the latitudinal differences in sunlight intensity, how might you expect the carrying capacity of a plant species found at the equator to compare with that of a plant species found at high latitudes? Explain your answer

Answers

Answer:

The carrying capacity of a plant species expect in the equator is higher as compared to the carrying capacity at high Latitudes. This is due to the equator the plants have more light available, so the ecosystem can give them better conditions to survive and reproduce. Remembering that the carrying capacity is the largest population size an ecosystem can support without degrading itself, in the equator would be higher as it can have better conditions of light, so they would survive and reproduce more and the largest population the ecosystem could support would be higher.

animal cell vs plant cell

Answers

Answer:

animal cell

Explanation:

Differentiate between pathogenicity and hypersensitivity; Also write different methods of inoculating the plants.

Answers

Answer:

As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.

Which of these is a benefit of fish farming?

A. It can deplete native fish populations


B. It can restock lakes depleted by recreational fishing


C. It can pollute natural bodies of water


D. It can pass diseases to native fish populations

Answers

Answer:

The answer to this would be B

Explanation:

B:It can restock lakes depleted by recreational fishing

2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False ​

Answers

Answer:

The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTION

MARK ME AS BRAINIST PLZ

does tomato have thick or thin exocarp?​

Answers

I think it’s thick

Explanation
Here, we describe the simultaneous transcriptome profiling of all five major cell types/tissues of the tomato fruit pericarp (Figure 1), including the outer epidermis (a single cell layer), collenchyma (approximately three to five cell layers in the Ailsa Craig cultivar used in this analysis), parenchyma

Brain researchers have found wider surface fissures, enlarged ventricles, and atrophy of the brain areas for regulating motivation, emotion, attention, actions, and perception in persons suffering from:________

a. bipolar disorder.
b. schizophrenia.
c. multiple personalities.
d. conversion disorders.

Answers

Answer:

B. Schizophrenia

Explanation:

yes

Which genotype would give you a wild type phenotype?

Answers

Answer:

C

Explanation:

do you think there is the roots in utricularia?​

Answers

Answer:

I think so

Explanation:

Should we clone animals that are going or have gone extinct (in other words bring them back
either from the brink of extinction or from extinction)? Explain your answer.

Answers

No, God gives and takes away, the world is heartless and kills entire species to extinction but it’s nothing that God didn’t already know would happen. Dinosaurs are no longer here there extinct for a reason, nowadays extinction comes from man but everything that happens in this world is Already written out in Gods book

Answer:

I think we should but people are preventing this though

Explanation:

I think we should because it might benefit the world and let scientists to discover this animal. But then I don't think so because animals that are/were extinct could perhaps be from climate change. Nowadays, people don't take this matter seriously causing habitats to be destroyed and animals to be extinct :) Like icebergs are melting that mean penguins are at risk of being extinct,if we did something then this situation will be prevented. However dinosaurs did become extinct and they did not come back so its probably just life and this is how god planned it:)

Describe the impact of technology on the environmental today

Answers

Explanation:

Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished

Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers

Answers

Answer:

....b........ melted snow

C because I just took a test like that

sexually produced offspring are indentical to their parent . true or false ?

Answers

This is true!!!!!!!!!!
Other Questions
tinh du no c v ngt What is the area of trapezoid DEFG? PLEASE SO THIS ASAP!!!MUST SHOW WORK how to change mixed fraction into improper fraction and improper to proper fraction easy way Imagine that you and a friend are going on a two-week trip aboard a sailboat. You have plenty of room for supplies on your boat; but once you leave the shore, you won't be stopping at a port or a grocery store for at least two weeks. You have a tiny refrigerator aboard the boat (similar in size to a college dorm refrigerator) and you have a small cooking stove, along with pots and pans and a host of serving dishes.Determine what foods you'll take with you on your journey and develop a three-page supply list. As you make your list, keep in mind the shelf life of products you choose, such as milk, and the storage constraints of those perishables. You'll also want to think about nutritional values so that you stay healthy during your journey and figure that into your final supply list.Write a two-page report that explains why you chose the items on your list and how you intend to prepare them while you're at sea. Remember that your response must include your three-page supply list. simplify the monomial11x^2 -3x^2 which of the following would a be a producer A developmental psychologist from the behaviorist school of thought would not recommend which of the following actions to deal with an unruly child?a.) Sit him down and explain to him how his behavior is negatively effecting those around himb.) When witnessing negative behavior immediately place the child on time outc.) Carry around small candies to give the child every now and then as long as they are behavingd.) Try to see what things in the environment set off negative behavior and remove them or avoid them Solve the system of equations.y = x2 + 3x - 4y= 2x - 4 Which is the function of a thesis statement? PLEASE HELP! How many integers $n$ satisfy $-4n\ge 12$ and $n+5>2$?? Your uncle offers you a choice of $112,000 in 10 years or $51,000 today. Use Appendix B as an approximate answer, but calculate your final answer using the formula and financial calculator methods. a-1. If money is discounted at 8 percent, what is the present value of the $112,000 What is the equation of the following graph in vertex form?Y=(X-3)^2-1Y=(X+3)^2-1Y=(X-4)^2-2Y=(X-4)^2+8 Suppose you exert a force of 314 N tangential to a grindstone (a solid disk) with a radius of 0.281 m and a mass of 84.2 kg What is the resulting angular acceleration of the grindstone assuming negligible opposing friction The sympathetic and parasympathetic nervous systems are both part of which division of the nervous system?the central nervous systemthe peripheral nervous systemthe somatic nervous systemthe autonomic nervous system Discuss the OSI Layer protocols application in Mobile Computing Which of the following numbers is between 0.08 and 0.4?(A) 0.019(B) 0.009(C) 0.109(D) 0.91(E) 0.409 i need help now! Mr. Morris is going to save money and replace his sailboat's mainsail himself. He must determine the area of the mainsail in order to buy the correct amount of material. Calculate the area of the parallelogram to determine how much material should be purchased. Be sure to explain how to decompose this shape into rectangles and triangles. Describe their dimensions and show your work. Describe how you will operate your business Guess Fallacy: and explain why1. Wife: You need to stop spending money on PS4 games.Husband: You spend the money on clothes and make-up, and you don't hear me complaining.2. People died of cancer before cigarettes were invented... So, smoking doesn't cause cancer." I thought of a number. I added 15, tripled it and then subtracted 3 from the result. I got 42. What was my number?