What purpose does the endosperm serve in the seed?

Answers

Answer 1

Answer:

Supporting embryonic growth

Explanation:

The endosperm plays an important role in supporting embryonic growth by supplying nutrients, protecting the embryo, and controlling embryo growth by acting as a mechanical barrier during seed development and germination.

Answer 2

Answer:

Supporting embryonic growth


Related Questions

Can someone tell me if it’s correct

Answers

Answer:

yes ur right

Explanation:

Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories

Answers

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

What is food energy?

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply

A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year

B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest

C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest

D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores

E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one​

Answers

Answer:

The correct answer is - A and C,

Explanation:

According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:

The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.

B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.

Answer:

A, C, D

Explanation:

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

what are cotyledons? & what is its use

Answers

Answer:

Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.

*You Can put this in your own words

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.

Answers

Answer:

C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.

Explanation:

Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.

Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.

Thus, the correct answer is option C.

which involves producers, consumers, and decomposers?

the water cycle

nitrogen fixation

evaporation

the carbon and oxygen cycles​

Answers

I would say the carbon and oxygen cycles

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

1. Identify the 4 major body systems shown below
A.————
B.————
C.————
D.————

Answers

A. Circulatory system
B. Nervous system
C.respiratory system
D. Digestive system
Hope this helped

DNA is wrapped around
and condensed into chromosomes.

• Genes are used as a set of instructions to produce proteins.

Proteins affect the
and function of organisms.
Chromosome

Answers

Answer:

- DNA is wrapped around nucleosomes and condensed into chromosomes.

- Proteins affect the traits and function of organisms.

Explanation:

Nucleosomes are the basic unit of compaction of DNA. Each nucleosome is composed of ~148 bp double-stranded DNA and an octamer of histone proteins, which include two molecules of each core histone: H2A, H2B, H3 and H4. Subsequently, nucleosomes are packaged into chromatin fibers so they can be densely compacted into chromosomes. On the other hand, proteins are molecules that play important (structural and enzymatic) functions in a cell. These proteins may affect the structure/function of a cell, thereby affecting a certain characteristic/trait to develop.

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

the process which takes place in guard cells but not in other epidermal cells is?​

Answers

Answer:

guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck

Photosynthesis

The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.

Difference in guard and epidermal Cells:

Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.

Photosynthesis does not take place in epidermal cell because:

The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.

Learn more:

brainly.com/question/9498584

FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY​

Answers

Answer:

quickly

Explanation:

Answer:

SLOWLY

Explanation:

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer: here ya go

Explanation: The lytic cycle is one of the two cycles of viral reproduction

Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.

Explanation:

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.
Other Questions
What is the total duration in minutes for the recorded lap times? Sandra's Lap Times(minutes)2.42.31.71.82.72.61.91.51.21.41.31.4A. 21.7B. 22.0C. 22.2D. 22.5 4. MN has an equation of 2x - y = 3. Which of the following is the equation of a lineperpendicular to MN and passes through the point (4,3)?A.1y = --X-52C, y = -x-2B.y = -2x-5D. y = -x + 52 How is energy produced by respiration stored A family spends 1/10 of it's annual income for housing 1/4 for food and clothing 1/5 for general expenses and 2/15 for entertainment what fractional part of their income is spent on these items altogether. 1. The graphs below represent functions defined by polynomials. For which function are the zeros of thepolynomials 2 and - 3? loolllllllll i neeeddd helpppp asapppppppp The Albertsons are purchasing a home for $400,000. They are financing 70 percent of the home's value. In addition to the down payment, they have the following closing costs: Lender's inspection fee $400 Loan origination fee 1.5% of the loan amount Notary public fee $60 Document recording fees $75Title search $300 What is the total amount of the closing costs? .help plz Some parents will drive 17 children to summer camp. Each parent can fit 4 children in a car.What is the fewest number of parents needed to drive all the children? help plsssssss !!!!!! Helpppp plssssss: )))) In your own words, describe the story of the blind man and the well. How does this story connect to the large global problems we face?Its about billions of changes Two parallel lines are cut by a transversal. What is the measure of 26?A. 180B. 90C. 123D. 57 How did the Columbian exchange lead to the development of capitalism The tallest Ferris wheel in the world is located in Singapore. Standing 42 stories high and holding as many as 780 passengers, the Ferris wheel has a diameter of 150m and takes approximately 30 minutes to make a full circle. Determine the speed of the riders (in m/s) on the Singapore Flyer. 5.6(x - 3) = -0.4x + 19.2 Write the number in 2 equivalent forms as a fraction, decimal, or percent. 0.75What is the equivalent fraction? find the slope and y intercept form equation from the table The main function of cell respiration is to produce A. glucose B. NADH and FADH2. C. CO2. D.mitochondria E. ATP.Again No links thank you! The energy that powers photosynthesis comes fromA. oxygen.B. water.C. the sun.D. chemicals. X is proportional to y where y>0 .y is increased by 44%work out the percentage increase in x