What is the slope of the line that contains these points?
х
15
17
19
21
10 2
14
26

Answers

Answer 1

Answer:

6

Step-by-step explanation:

The slope (m) can be found using the formula ...

 m = (y2 -y1)/(x2 -x1)

Any pair of points will do. We can use the first two.

 m = (2 -(-10))/(17 -15) = 12/2

 m = 6

The slope of the line is 6.


Related Questions

can u guys help i need to make this longer lol

Answers

I don’t under stand the question. What do you want me to answer

Susie is paying $568.97 every month for her $150,000 mortgage. If this is a 30 year mortgage, how much interest will she pay over the 30 years of payments?

Answers

204,829.2
Multiple 12 by 30 because 12 is how many mouths is in a year and she is paying for 30 once you multiply that you multiple what ever you got by 568.87

Answer:

Step-by-step explanation:

Take the paying multiply by months then take the years - the total loan

so you'd have 568.97(12)30-150000=54829.20

Value of x
Give reasons

Answers

50 bc since all the angles in a triangle are 180 degrees the other angle in the complete triangle is 40 degrees and since the lines are parallel it would be a corresponding angle to the angle beside x, then you would take 90+40 +x= 180 bc it’s a straight angle
you would get 50

Answer:

50 degrees

Step-by-step explanation:

You have the opportunity to purchase a MLB Franchise. The probability distribution of expected returns for the franchise is as follows:
Probability Rate of Return
0.1 –20%
0.2 0%
0.4 7%
0.2 15%
0.1 25%
The expected rate of return for your investment in the MLB Franchise is____Expected rate of return = ∑Piki. The standard deviation is_____.

Answers

Answer:

The expected rate of return is 6.3%.

The standard deviation is of 11.29%.

Step-by-step explanation:

Expected rate of return

Multiply each rate by its probability. So

[tex]E = 0.1(-20) + 0.2(0) + 0.4(7) + 0.2(15) + 0.1(25) = 6.3[/tex]

The expected rate of return is 6.3%.

Standard deviation:

Square root of the difference squared between each value and the mean, multiplied by the probability. So

[tex]S = \sqrt{0.1(-20-6.3)^2 + 0.2(0-6.3)^2 + 0.4(7-6.3)^2 + 0.2(15-6.3)^2 + 0.1(25 - 6.3)^2} = 11.29[/tex]

The standard deviation is of 11.29%.

please help me. this is my last problem and i’m clueless.

Answers

Answer:

-3

Step-by-step explanation:

so you SUBSTITUTE -2 in for z

ok i think they are trying to be tricky here

so

-1 - (-(-2))

inside parentheses, the two negatives are going to cancel eachother out.

now you have

-1 - (2)

which is

-1 - 2

-1 minus 2 is -3

Find x
I got 5 but I don’t know if that’s correct. Please help

Answers

It’s 5 plz mark Brainlyist.

The rectangular pyramid below has a height of 6 inches what is the volume of the pyramid? A. 18 cubic inches
B. 40 cubic inches
C. 120 cubic inches
D. 360 cubic inches

Answers

I think it’s D sorry if I’m wrong

The Volume of rectangular Pyramid whose height inches is 40 cubic inches.

What is the Volume of rectangular pyramid?

The volume of the rectangular pyramid is defined as the capacity of the rectangular pyramid. In geometry, a rectangular pyramid is a three-dimensional geometric shape that has a rectangular base and four triangular faces that are joined at a vertex.

Here, height of pyramid = 6 inches

base area = 4 X 5 = 20 sq. inches

Volume of rectangular pyramid = 1/3 × Base Area × height

                                                       = 1/3 X 20 X 6

                                                      = 120 / 3

                                                      = 40 cu. inches

Thus, the Volume of rectangular Pyramid whose height inches is 40 cubic inches.

Learn more about rectangular pyramid from:

https://brainly.com/question/21334693

#SPJ2

Which is the lower rate 165 students on 5 buses or 140 students on 4 buses

Answers

Answer:

140 students on 4 buses

On a drive from one city to​ another, the person averaged 51 mph. If he had been able to average 72 ​mph, he would have reached his destination 7 hrs earlier. What is the driving distance between one city and the​ other?

Answers

Answer: 1224 miles

Step-by-step explanation:

Given

the average speed of a person is 51 mph

If speed is increased to 72 mph, he would have reached 7 hr earlier

Suppose d and t be the distance and time taken

[tex]\Rightarrow t_1=\dfrac{d}{51}[/tex]

If the speed is 72 mph

[tex]\Rightarrow t_2=\dfrac{d}{72}[/tex]

Also, [tex]t_1-t_2=7[/tex]

[tex]\Rightarrow \dfrac{d}{51}-\dfrac{d}{72}=7\\\\\Rightarrow \dfrac{1}{51}-\dfrac{1}{72}=\dfrac{7}{d}\\\\\Rightarrow \dfrac{24-17}{1224}=\dfrac{7}{d}\\\\\Rightarrow \dfrac{7}{1224}=\dfrac{7}{d}\\\\\Rightarrow d=1224\ miles[/tex]

the area of a 12-cm-wide rectangle is 288 cm^2 what is its length?

Answers

Answer:

24cm

Step-by-step explanation:

The area of the rectangle is length × breadth. You already know the area and the breadth, so you can find the length.

288cm² = length × 12cm

length = 288cm² ÷ 12cm

           = 24cm

identify each coefficient for 3m. this question is on my homework what Is the answer?

Answers

Answer: 3

Step-by-step explanation: The number in front of your variable is called your coefficient so we say that 3 is the coeficient.

Make sure to understand that a variable

is just a letter that represents any number.

The number of students, s, is at most 30.​

Answers

Answer:

I'm confused

Step-by-step explanation:

maybe more context?

Adalia has a cooler where the inside is in a shape of a rectangular prism. The inside of the cooler is 20 inches wide, 14 inches high, and 12 inches long. What is the volume in cubic inches of the inside of the cooler?
( will give brainliest if u help)

Answers

Answer:

A.

Step-by-step explanation:

took test

I think the answer is A

Work out (5 x 10^3) (9 x 10^7)
Give your answer in standard form.

Answers

Answer:

(5 x 10^3) (9 x 10^7) = 5 × 9 × 10^3 × 10^7 = 45 × 10^10

(5x10^3)(9x10^7)=4.5x10^11
standard form move decimal to the right 11 times, so 450000000000

What is the first and second step to solving
3x+4=34

Answers

move 4 over to the other side, making it negative
3x=34-4
3x=30
divide both sides by 3
x=10

Answer:

X = 10

Step-by-step explanation:

3x+4=34

3x = 34 - 4

3x = 30

X = 30/3

X = 10

Given that f(x) = -3x, g(x) = x + 3 and h(x) = 3f(x + 1) = g(x), then
what is the value of h(2)?

Answers

Answer:

hkhqews

Step-by-step explanation:

nc2ecnw

Help math plzshnsndnfjc

Answers

Answer:

11 inches

Step-by-step explanation:

So first I don’t typically go with fractions so I broke 2 3/4 down into a decimal which is:

2.75

Then the index card is

4 by 2.75

Then you multiply the sides

4 x 2.75

= 11 inches

Mrs Brown and Mrs Jones make 4 dozen sandwiches in half an hour in Mrs Jones’ small kitchen. If they had 30 friends in to help, how many sandwiches could be made in the same time?

Answers

Answer:

1488 sandwiches in thirty minutes

Step-by-step explanation:

The diagram below shows a circular pizza with a diameter of 16 inches. The pizza is in a square box with side lengths of 18 inches. In square inches, how much of the box is empty?Use π = 3.14 and round your answer to the nearest hundredth.

Answers

Answer:

pls do mark my answer as the brainliest..........

Step-by-step explanation:

portion of square empty =  256 - 153.86 = 102.14cm^2

How can you write the expression 7(b-2) in words?

A. two subtracted from the quotient of seven divided by b

B. seven added to difference of b minus two

C.the quotient of seven divided by b minus two

D. two subtracted from seven times b

E. the product of seven and the difference of b minus two

Answers

E. The product of 7 and the difference of b - 2 :^)

I will give you b if your answer is correct I only mark first answer so please help me

Answers

Answer:

b

Step-by-step explanation:

...............................

Answers

I believe it’s 7/10

the manager of a school radio station is conducting a survey she wants to find out which type of music introvert how would the manager most likely get a random sample that represents the school population

Answers

Answer:

type of music students prefer. How would the manager most likely get a random sample

that represents the school population?

Step-by-step explanation:

I may or may not have given my explanation in my answer 0.0

M/6-7=2/3 pls help plssssd

Answers

Step-by-step explanation:

M/6-7=2/3

M/6=2/3+7

M=23/3×6

M=23×2=46

Three landmarks of baseballachievement are Ty Cobb’s batting average of 0.420 in 1911,Ted Williams’s 0.406 in 1941, and George Brett’s 0.390in 1980. These batting averages cannot be compared directly becausethe distribution of major league batting averages has changed overthe years. The distributions are quite symmetric and (except foroutliers such as Cobb, Williams, and Brett) reasonably normal.While the mean batting average has been held roughly constant byrule changes and the balance between hitting and pitching, thestandard deviation has dropped over time. Here are the facts:
Decade
Mean
Standard Deviation
1910s
0.266
0.0371
1940s
0.267
0.0326
1970s
0.261
0.0317
Compute the standard units for the batting averages of Cobb,Williams, and Brett to compare how far each stood above his peers.Who is the better player of the three?

Answers

Answer:

Ted Williams has the highest standardized score, hence Williams is the best of the three

Cobb is the second highest and hence, the better player

George Brett is third

Step-by-step explanation:

Given the data:

Decade : 1910 __ 1940 ____ 1970

Mean, μ: 0.266 __0.267 ___ 0.261

S/dev, σ : 0.0371 _ 0.0326 __ 0.0317

To compute the standard unit for batting averages, we obtain the standardized score for each of Cobb,Williams, and Brett.

Standardized score (Zscore) : (x - μ) / σ

Cobb, x = 0.420

Ted Williams, x = 0.406

George Brett, x = 0.390

COBB:

Zscore = (0.420 - 0.266) / 0.0371 = 4.1509

Ted Williams :

Zscore = (0.406 - 0.267) / 0.0326 = 4.2638

George, Brett = (0.390 - 0.261) / 0.0317 = 4.0694

Ted Williams has the highest standardized score, hence Williams is the best of the three

Cobb is the second highest and hence, the better player

George Brett is third

please dont show this

Answers

Uhhh Don’t show what?

Please help with math question.

Answers

9514 1404 393

Answer:

  C

Step-by-step explanation:

Multiply numerator and denominator by the conjugate of the denominator.

  [tex]\displaystyle\frac{7}{-4-\sqrt{x}}=\frac{7(-4+\sqrt{x})}{(-4-\sqrt{x})(-4+\sqrt{x})}=\frac{-28+7\sqrt{x}}{16-x}=\boxed{\frac{7\sqrt{x}-28}{16-x}}[/tex]

A soda bottling plant uses automated filling machines to fill 2-liter bottles with soda. The plant can produce 8000 bottles of soda in an 8-hour shift. The plant’s quality manager wants to determine how well the process is operating. He takes a sample of 100 bottles from the bottling line and determines that on an average, each bottle contains 2.07 liters of soda, with a standard deviation of 0.06 liters. The specification limits for a bottle of soda are 2.1 liters and 1.9 liters

Answers

Answer:

0.6892 = 68.92% of bottles are within specification.

Step-by-step explanation:

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the zscore of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the pvalue, we get the probability that the value of the measure is greater than X.

On average, each bottle contains 2.07 liters of soda, with a standard deviation of 0.06 liters.

This means that [tex]\mu = 2.07, \sigma = 0.06[/tex]

The plant’s quality manager wants to determine how well the process is operating.

To do this, we find the proportion of bottles within specification.

The specification limits for a bottle of soda are 2.1 liters and 1.9 liters

This is the pvalue of Z when X = 2.1 subtracted by the pvalue of Z when X = 1.9. So

X = 2.1

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{2.1 - 2.07}{0.06}[/tex]

[tex]Z = 0.5[/tex]

[tex]Z = 0.5[/tex] has a pvalue of 0.6915.

X = 1.9

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{1.9 - 2.07}{0.06}[/tex]

[tex]Z = -2.83[/tex]

[tex]Z = -2.83[/tex] has a pvalue of 0.0023

0.6915 - 0.0023 = 0.6892

0.6892 = 68.92% of bottles are within specification.

I need help with Mean, Median and Mode​

Answers

Answer:

there is no attachments but   The mean (average) of a data set is found by adding all numbers in the data set and then dividing by the number of values in the set. The median is the middle value when a data set is ordered from least to greatest. The mode is the number that occurs most often in a data set.

Step-by-step explanation:

х
f(x
Which exponential function is represented by the
values in the table?
-2
AW
-1
3
2
O 3
f(x) = 3(2)
O f(x) = 2(2)
O f(x) = 3(34)
O f(x) = 2(3)
0
3
1
6
1
2
2
12

Answers

Answer:

[tex]y = 3(2)^x[/tex]

Step-by-step explanation:

Given

The attached table

Required

Determine the exponential function

An exponential function is represented as:

[tex]y = ab^x[/tex]

From the table;

[tex](x,y)=(0,3)[/tex]

So:

[tex]y = ab^x[/tex]

[tex]3 = a * b^0[/tex]

[tex]3 = a * 1[/tex]

[tex]3 = a[/tex]

[tex]a = 3[/tex]

Also:

[tex](x,y) = (1,6)[/tex]

So:

[tex]y = ab^x[/tex]

[tex]6 = a * b^1[/tex]

[tex]6 = a * b[/tex]

Substitute [tex]a = 3[/tex]

[tex]6 = 3 * b[/tex]

Solve for b

[tex]b = 2[/tex]

So:

[tex]y = ab^x[/tex]

[tex]y = 3(2)^x[/tex]

The exponential function represented by the values is f(x) = 3(2)ˣ

Exponential function

An exponential function is in the form:

y = abˣ

where y, x are variables, a is the initial value of y and b is the multiplier.

From the table, at point (0, 3):

3 = ab°  

a = 3

At point (2, 12):

12 = ab²

12 = 3b²

b² = 4

b = 2

f(x) = 3(2)ˣ

The exponential function represented by the values is f(x) = 3(2)ˣ

Find out more on Exponential function at: brainly.com/question/12940982

Other Questions
what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Juan wants to buy a doll house that is 45% off. The original price is$74.85.What is amount of discount (nearest hundredth)?Answer this quick pls!! :,) Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee Create a complete sentence from each of the following phrase fragments. Add capitalization and punctuation wherever necessary.EllenExample1. has been a gymnast.managing the store International trade theory attempts to explain why nations trade and to help predict the direction, composition, and volume of goods that will be traded A variety of different theories have been proposed over the past several centuries to help explain the existence of trade between nations and to help predict whether trade will occur, what products or services will be traded, the direction of this trade, and the volume of this trade. Understanding the differences between these theories helps managers and policy makers to understand whether and how to pursue trade opportunities internationally Drag each of the general characteristics listed to the international trade theory that it is most associated with:International Trade Theory General Characteristics Government stimulates trade by means of protectionism Mercantilism Factors that can drive competitive advantage for one economy over another Absolute Advantage Trade influenced by relative income levels Comparative Advantage Trade materials that are abundant Trade most efficiently produced goods Differences in Resource Endowments Overlapping Demand Trade goods and services at a lower opportunity cost than others Diamond Model of National Competitive Advantage imeter, Area, Dimensions - Real World Hacice estions Notes/Examples 1. A triangular garden has sides measuring 14 feet, 17 feet, and 28 feet. If Cody is laying a brick ETER border around the garden, how many feet of brick will he laya uchs Hihe rectangular path Why did the cost of spices decreased so much? Who's the first person to reach the moon how a positive personal lifestyle plan may promote meaningfulness of life Soro bought a $50.00 bus card at the beginning of the week. Each bus ride costs $2.50. He needs to have at least $20.00 on his card at the end of this month.To determine how many bus rides he can take between now and the end of this month, Soro wrote and solved the following inequality:50 minus 2.5 x greater-than-or-equal-to 20. Negative 2.5 x greater-than-or-equal-to negative 30. x greater-than-or-equal-to 12.What error, if any, did Soro make when writing or solving this inequality Which of the following would be a good hook for a personal essay? Jim began a 222-mile bicycle trip to build up stamina for a triathlete competition. Unfortunately, his bicycle chain broke, so he finished the trip walking. The whole trip took 8 hours. If Jim walks at a rate of 5 miles per hour and rides at 33 miles per hour, find the amount of time he spent on the bicycle. Find the unit rate.15 plants in 5 rows = BLANK plants per row 50 POINTS + BRAINLIESTPLEASE DONT STEAL POINTS THIS IS MY 2ND TIME ASKING THIS QUESTION if m 1 =7x and m 4 =3x +20 what is the value of x