What is the process of Asexual and Sexual reproduction of Jellyfish?
Plz give BOTH answers!!

Answers

Answer 1

Answer:Jellyfish reproduction involves several different stages. In the adult, or medusa, stage of a jellyfish, they can reproduce sexually by releasing sperm and eggs into the water, forming a planula.

sexual is when there is a mom and dad and a sexual is when a single organism gives birth usually they look the exact same as the species  

Explanation:


Related Questions

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

please help with this question​

Answers

Answer:

a -5

d -2

c-3

b-4

e - 5

Explanation:

I'm guessing this is the answer

1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?​

Answers

Answer: 1. The nitrogen cycle is a biogeochemical cycle.

2. The carbon cycle is a biogeochemical cycle.

Explanation:

1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.

2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.

triangular shaped land mass found on land ​

Answers

Answer:

beautiful

Explanation:

serioudly I like it

Deltas are beautiful landforms, especially when viewed from above. Roughly triangular in shape, deltas are full of complex, wonderful detail: swirling, multi-colored sediments broken by serpentine, miniature river channels.

I really need help on this cause i read the assignment and they didn't explain it well. :(

Answers

Explanation:

Sir kindly take a clearer shot it the questions for assistance

How can the arrangement of atoms help explain how the white phosphorus and red phosphorus can both be pure phosphorus substances?

Answers

Answer:Phosphorus is a chemical element with symbol P and atomic number 15. A multivalent nonmetal of the nitrogen group, phosphorus as a mineral is almost always present in its maximally oxidized state, as inorganic phosphate.

Explanation:

Chemical element phosphorus has the atomic number 15 and the letter P in its symbol. Phosphorus, a multivalent nonmetal belonging to the nitrogen group, is generally always found in the form of inorganic phosphate, which is phosphorus in its maximally oxidized state.

What is phosphorus?

The mineral phosphorus, which is also available as a supplement, is naturally present in many foods. It serves the body in a multitude of capacities. It is a crucial component of cell membranes, bone, and teeth. It maintains a healthy range of blood pH and aids in the activation of enzymes.

All tissues and cells must have phosphorus for growth, maintenance, and repair as well as for the creation of DNA and RNA, the genetic building blocks. The balance and usage of other vitamins and minerals, including vitamin D, iodine, magnesium, and zinc, depend on phosphorus as well.

Thus, Chemical element phosphorus has the atomic number 15.

For more information about phosphorus, click here:

https://brainly.com/question/4622631

#SPJ2

PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.

Answers

It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.

What are the important factors for the experiment?

This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:

Acceleration: This factor is the one you will measure in your experiment.

Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.

Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.

Steps for the experiment:

Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.

Throw different objects with different masses: You can begin with light objects and move into heavier objects.

Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.

Learn more about acceleration in:

brainly.com/question/12134554

#SPJ1

What is seed dispersal? Name some agents of seed dispersal​

Answers

Answer:

The Process by which seeds spread over a wide area is known as seed dispersal..

some agents

Air

water

animals

etc..

Answer:

Seed dispersal is the movement, spread or transport of seeds away from the parent plant.

The most common methods are :

wind, water, animals, explosion and fire.

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

**anatomy & physiology question**

if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?

Answers

Answer:

0.8mm.

Explanation:

If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.

What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences​

Answers

Answer:

A

Explanation:

I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

Provide at least 1 example of a mutation
that does not have a negative effect on
the individual.
PLEASE HELP ME

Answers

i honestly don’t know but i’m guessing maybe having more fingers or something

Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.

Answers

Answer: Its A my friend, how it helps!.

Explanation: I just completed the Test.

The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.

What do you mean by adaptation?

In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.

The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.

Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.

Learn more about adaptation:

https://brainly.com/question/12534888

#SPJ2

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

Feeding problems may develop during the preschool years partially because of:_______

a. decreased appetite associated with decreased growth rate.
b. increased appetite associated with increased growth rate.
c. increased metabolic rate.
d. increased need for finger foods.

Answers

Answer:

The correct option is A.

decreased appetite associated with decreased growth rate

Explanation:

Feeding problems may develop in preschool age because of decreased appetite associated with decreased growth rate and this is because at the preschool age, there is no rapid growth, the growth rate is reduced which is as a result of decreased appetite for food. We all know that food supply the body with energy and necessary nutrients for growth. When there is decreased appetite enough food needed for growth will not be consumed , hence decrease growth rate.

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

Giving points and brainliest to the first person

Answers

i am uwu


!!!!!!!!! mememememmemememmeme

To find new and alternative farming methods and practices, private companies often fund their own research and development teams.


False

True

Answers

I think the answer is false

:):):):):)

Answer:

FALSE ALL DAY LONG

Explanation:

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

HELP QUICK HELP ILL MARK U BRAINLIST

Answers

Answer:

B or A I think B

Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem


WILL GIVE BRAINLIEST

Answers

1 population
2 species
3 economists
4 biome
5 biosphere

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

uses of crush in the farm​

Answers

Answer:

ok i dont understand what that is

Explanation:

Answer: The overall purpose of a crush is to hold an animal still to minimise the risk of injury to both the animal and the operator while work on the animal is performed.

The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference

Answers

Answer:

The coefficient of interference, I, is 0.1 (10% expressed as a percent)

Explanation:

Available data:

genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.

The coefficient of interference, I, is complementary with CC.

I = 1 - CC

To calculate the coefficient of coincidence, CC, we must use the next formula:

CC= observed double recombinant frequency/expected double recombinant frequency    

Note:  

observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.

By knowing the positions of genes, we can estimate the distances in MU between them per region.

The  distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MU

Now that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.

recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06

Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:

EDRF = recombination frequency in region I x recombination frequency in region II.

EDRF = 0.13 x 0.06 = 0.0078

Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:

ODRF = number of double crossovers / total number of individuals

ODRF = 7/1000 = 0.007

Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.

CC = ODRF/EDRF

CC =  0.007 / 0.0078

CC = 0.9

And by knowing the CC we can also get the coefficient of interference, I.

I = 1 - CC

I = 1 - 0.9

I = 0.1 = 10% (expressed as a percent)

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

Other Questions
Read the poem by Jamaal MayThe boy decides soldiers can no longer be dead, so he begins to dig.Graves are shallow enough that, using only his hands, he quickly finds a limbburied without a corpse. He brushes dirt away, slides the arm into a pocket of overalls.Until all soldiers are found and placed in seperate ziplock bags,his fingers rake soil, churn the dark earth. His brotherfinds him afterwards filling a sink to rinse the crevices and metal joints, worriedhe bathes the plastic infantry too carefully. As if they had families, As if they were menRespond to the following questions:How does the poem reflect the speakers cultural experience?Grupo de escolhas da perguntaA) It reveals how the author sees the dehumanization of soldiers.B) Peace requires a soldiers sacrifice.C) It explains how the soldiers of the time are forced to risk their lives in combat.D) It describes the soldiers of the time are called to battle for freedom. 1. 42+14x2. 3(2x + 9) which expression is equivalent to 3x - -3y Choose the correct label for the solution to each system of equations from the drop-down menus. What is n2+5 If n=5? Who watched to the news yesterday night Please hurry. I will give brainliest. :) How do u deal with stress? The most reasonable answer gets brainly All of these events depict an internationalist foreign policy EXCEPT aEnacting high tariffs bFree trade agreements cThe Korean War dThe Cold War Oakland is located across a bay from San Francisco in western California. What does this describe about Oakland?OA. spatial interactionOB.scaleOC.situationOD. distance Identify whether the sentence below is a fragment, run-on or a correct sentence.Lasagna, a baked dish, usually consists of layers of boiled lasagna pasta, tomato sauce, cheese, and meat lasagna can also be made with spinach instead of meat.A.FragmentB.Run-onC.Correct The law of universal gravitation states that a gravitational force exists between all objects in the universe. This force is directly proportional to the masses of the two objects and inversely proportional to the distance between them.This principle is a law because A. it cannot be tested through a controlled scientific investigation. B. it is subject to change as new technology and evidence emerges. C. it is contradictory to ideas proposed by other scientists. D. it has been demonstrated to be without exception under certain stated conditions Jackson has twice as many cards as his friends Alex and Chase combined. Alex has 55 Cards in his collection. Jackson Has 200 cards in his collection. How many cards does Chase have in his collection? 27. How was the design of the Chernobyl plant different than most modern reactors?a. The containment building had a dome shape to minimize impact of explosion.b. The plant was built close to a river to have a constant supply of fresh water.c. Graphite was used instead of water as a moderator solution in the reactor.d. The plant design was not significantly different than other reactors. 5. What does Malcolm say is hisfirst big step towardself-degradation? What is theultimate motivation behind gettinga conk? Help please Malcolm x. hii guys helpif you can Opportunity cost occurs because of a producers need tolimit resources.protect resources.allocate resources.spend resources.Mark this and return You paint four walls. Each wall is a rectangle with a length of 18 feet and a height of 12 feet. One gallon of paint covers about 320 square feet. How many gallons of paint do you need in order to cover the walls? Answers to these 3 questions ? Plllz help me I need helpp