What is the god particle

Answers

Answer 1

Answer:

Explanation:

hThe media calls the Higgs boson the God particle because, according to the theory laid out by Scottish physicist Peter Higgs and others in 1964, it's the physical proof of an invisible, universe-wide field that gave mass to all matter right after the Big Bang, forcing particles to coalesce into stars, planetsig


Related Questions

A missile is moving 1350 m/s at a 25° angle it needs to hit a target 23,500 m away in a 55° direction in 10.2 seconds what is the magnitude of its final velocity

Answers

Answer:

3504 m/s

Explanation:

Let x be the horizontal component of distance

y - vertical component of distance

t-time

ax- horizontal component of acceleration

ay-Vertical component of acceleration

Vx-horizontal component of velocity

Vy-Vertical component of velocity

horizontally: x = V_x ×t + ½×a_x×t²  

plugging the values we get

23500× cos 55º = 1350×cos25.0º × 10.20 + ½×a_x× (10.20)²  

⇒ax = 19.2 m/s²  

Moreover,

V'x = V_x + a_x×t = 1350×cos25.0º + 19.2×10.20= 1419 m/s  

similarly in vertical direction:

y = V_y×t + ½×a_y×t²  

23500×sin55º = 1350×sin25.0º×10.20s + ½×a_y×(10.20)²  

⇒a_y = 258 m/s²  

Also,

V'y = V_y + a_y×t = 1350×sin25.0º + 258×10.20 = 3204 m/s  

Therefore

V = √(V'x² + V'y²) = 3504 m/s  

therefore,  magnitude of final velocity of missile=3504 m/s

THANKS  

3

5.0

(7 votes)

Not the answer you're looking for?

FIND MORE

Previous

Next

Manetho

Manetho

Rank: Ambitious

29830/500

0/5

Your influence

1

14h : 28m

Answering Streak

Answer a question in time to keep your streak going and the unlocks coming.

Fun fact

An apple, potato, and onion all taste the same if you eat them with your nose plugged

1

2

2

Get +4

bonus

2

3

3

Get +6

bonus

3

Last 7 days

Overall

Your stats from the last 7 days compared with the previous 7 days

Popularity

881

People learning from your answers.

+4%

Brainliest

What form of energy does a block of chocolate have?

Answers

Answer:

Chemical Energy

Explanation:

Den pushes a desk 400 cm across the floor. He exerts a force of 10 N for 8 s to move the desk. What is his power output? (Power: P = W/t) 1.25 W 5 W 40 W 500 W

Answers

Answer:

5 W

Explanation:

The formula of the power is:

● P = W/t

W is the work and t is the time needed to do it(in seconds)

Let's calculate first the work that the force exerced:

W = Vector F . Vector d

D is the distance ( here 400 cm wich is 4 m)

Make a representation to see how are the vectors F and V.(picture below)

The vector F and d are colinear since Den is pushing the desk on the ground.

● W = 4 × 10 = 40 J

J is Joule

■■■■■■■■■■■■■■■■■■■■■■■■■■

● P = W / t

● P = 40/ 8

● P = 5 W

The power output of the force of 10N for 8 seconds to move the desk is 5 watts. Thus, the correct option is B.

What is Power?

Power is the amount of energy which is transferred or converted per unit time. In the SI system of Units, the unit of power is the watt, which is equal to one joule per second time.

We Know, P = W/t

where, P = Power,

W = Work done,

t = Time taken

P = F × s/t

where, F = Force applied,

s = distance travelled,

t = time taken

Here, F = 10N

s = 400cm = 4m

t = 8 sec

Substitute their values into the expression,

P = 10 × 4/8

P = 10 × 1/2

P = 5 Watt

So, the power output will be 5 watts.

Therefore, the correct option is B.

Learn more about Power here:

https://brainly.com/question/287674

#SPJ6

A body decelerates uniformly to a constant speed and after some time it accelerates uniformly Draw the shape of speed time graph for such a motion . Label the three sections of this graph. What is the quantity which is measured by the area occupied under speed time graph ?

Answers

Answer:

here I am just giving an idea of how the graph will be like ...

In the pic..

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

:)

Can someone explain how the weight of the block is 10.26N, with reference to an appropriate law of motion?

Answers

this process is called parellelogram method of resolving vectors.

One glass microscope slide is placed on top of another with their left edges in con- tact and a human hair under the right edge of the upper slide. As a result, a wedge of air exists between the slides. An interference pattern results when monochromatic light is incident on the wedge. What is observed at the left edge of the slides? a. A dark fringe b. A bright fringe c. Impossible to determine

Answers

Answer:

A dark fringe

A long, straight, horizontal wire carries a left-to-right current of 40 A. If the wire is placed in a uniform magnetic field of magnitude 3.7 ✕ 10−5 T that is directed vertically downward, what is the resultant magnitude of the magnetic field 22 cm above the wire (in T)?

Answers

Answer:

The magnitude of the resultant of the magnetic field is [tex]4.11\times10^{-5}\ T[/tex]

Explanation:

Given that,

Current = 40 A

Magnetic field [tex]B=3.7\times10^{-5}\ T[/tex]

Distance = 22 cm

We need to calculate the magnetic field

Using formula of magnetic field

[tex]B'=\dfrac{\mu_{0}I}{2\pi r}[/tex]

Where, r = distance

I = current

Put the value into the formula

[tex]B'=\dfrac{4\pi\times10^{-7}\times20}{2\pi\times0.22}[/tex]

[tex]B'=1.8\times10^{-5}\ T[/tex]

We need to calculate the magnitude of the resultant of the magnetic field

Using formula of resultant

[tex]B''=\sqrt{B^2+B'^2}[/tex]

Put the value into the formula

[tex]B''=\sqrt{(3.7\times10^{-5})^2+(1.8\times10^{-5})^2}[/tex]

[tex]B''=4.11\times10^{-5}\ T[/tex]

Hence, The magnitude of the resultant of the magnetic field is [tex]4.11\times10^{-5}\ T[/tex]

PLS HELP ME Define Derived Quantities ?

Answers

Derived Quantities

Explanation: Those physical quantities which are derived from fundamental quantities are called derived quantities and their units are called derived units.  e.g., velocity, acceleration, force, work etc.

Answer:

These are quantities calculated from two or more measurements

Explanation:

They can't me measured directly.

They can only be computed.

They are calculated in PHYSICAL SCIENCE.

hope it helps.

A high-voltage powerline operates at 500000 V-rms and carries an rms current of 500 A. If the resistance of the cable is 0.050Ω/km, what is the resistive power loss in 200 km of the powerline?

Answers

Answer:

2,500,000W or 2.5MW

Explanation:

The power lost due to resistance is given by I^2R. We must first obtain R as follows;

Resistance per kilometer= 0.050Ω/km

Distance covered= 200km

R = 200km x 0.050Ω/km = 10Ω

The lost power as a 500A current passes through the powerline is:

P = I²R

P= 500² x 10

P= 2,500,000 W or 2.5MW

The resistive power loss in 200 km of the powerline is of 2.5 MW.

Given data:

The root mean square voltage is, V' = 500000 V.

The magnitude of current through the power line is, I =500 A.

The magnitude of resistance of cable is, R = 0.050 Ω/km.

The length of powerline is, L = 200 km.

Whenever there is a flow of current through the wire, then there are various losses out of which the power loss is a major factor. The mathematical expression for the power loss is given as

P = I²R

Solving as,

P= 500² x 10

P= 2,500,000 W or 2.5MW

Thus, we can conclude that the resistive power loss in 200 km of the powerline is of 2.5 MW.

Learn more about the resistive power loss here:

https://brainly.com/question/15158529

You have a cup with 50cm filled with water. How much pressure will the water act on the bottom of the cup? The density of water is 1000kg/m^3 and g = 10N/kg

Answers

Answer:

5000 N/m².

Explanation:

The following data were obtained from the question:

Density (d) = 1000 kg/m³

Acceleration due to gravity (g) = 10 N/kg

Height (h) = 50 cm = 50/100 = 0.5 m

Pressure (P) =.?

Pressure is related to density and height by the following equation:

P = dgh

Where

P is the pressure.

d is the density.

g is the acceleration due to gravity.

h is the height.

With the above formula, we can obtain the pressure at the bottom of the cup as follow:

P = dgh

P = 1000 x 10 x 0.5

P = 5000 N/m²

Therefore, the pressure at bottom of the cup is 5000 N/m².

A charge (uniform linear density = 8.8 nC/m) lies on a string that is stretched along an x axis from x = 0 to x = 3.1 m. Determine the magnitude of the electric field at x = 5.2 m on the x axis.

Answers

Answer:

answer= 73.1256 [tex]i[/tex]

Explanation:

The electric charge linear density is equal to 8.8 x[tex]10^{-9}[/tex]

the length of the string is 3.1m

The magnitude of the electric field at the length of the string equal to 5.2 meters can be calculated with the formula ;

- E = λ / 4πε₀ [ [tex]l[/tex]  / α ( α +

Solution:

E =  8.8 x[tex]10^{-9}[/tex] / 4πε₀ [ 3.1/ 5.2( 5.2 + 3.1) ] [tex]i[/tex]

= 1018.0995 [0.07183] [tex]i[/tex]

=  73.1256 [tex]i[/tex]

Is the ultraviolet ray monochromatic or polychromatic?​

Answers

Answ

In real world application Ultraviolet is not a color as it it can’t be seen by the human eye. It is a high frequency part of the Suns electromagnetic radiation. Even though UltraViolet sounds like a color, the Ultra in this case signifies that it is beyond Violet and thus beyond the visible part of the electromagnetic spectrum. They are not depicted with a color on spectrum charts, since we can’t see it we can’t truly classify it as a color no more than can we equate the other parts of the spectrum like XRays, Gamma Rays and Radio Waves with colors. These and other non-visible parts of the spectrum are measured instead with wavelengths. So the answer is no they would not be monochromatic, or any color at all.

Red, Orange, Yellow, Green, Blue, Indigo and Violet are the visible colors of the electromagnetic spectrum. They, combined together are called white light and our atmosphere acts like a prism to divide them into separate and apparently distinct colors. Outside the visible Red you have Infrared which is invisible to the human eye and is the heat we feel from the sun. Outside the Violet end of the visible spectrum is where UVA, UVB and UVC are found, and these are the eye and skin damaging rays. UV rays are also invisible to the human eye (but visible to certain birds of prey such as raptors

Explanation:

At what altitude the value of ‘g’ would become one fourth (¼)of the surface of the earth?

Answers

Answer:

Explanation:

For acceleration due to gravity g , the expression is

g = GM / R² , where G is gravitational constant M is mass of the earth and R is radius of the earth .

At height h , let the value of it becomes g / 4 , so

g / 4 = GM / ( R + h )²

dividing

4 = [( R+ h)² / R² ]

2 = (R + h) / R

2 = 1 + h / R

h / R = 1

h = R

So at height equal to radius of the earth , acceleration due to gravity becomes 1 /4 of value on the surface of the earth .

Select the correct answer. Rita is a registered dietician. What does her work entail? A. prescribing medication for clients B. cooking healthy meals for students C. demonstrating how to use gym equipment D. making recommendations for healthy eating habits

Answers

Answer:

D

Explanation:

The answer is D because:

A) Only doctors are allowed to prescribe medications.

B) Rita is not a chef/cook.

C) Rita is not a personal trainer

D) The job of a dietican is to provide reccomendations to their clients in order for them to implement a healthy lifestyle via consuming what is best for them.

Hope this helps :)

Answer:

D.) Making recommendations for healthy eating habits

Explanation: PLATO :)))

Write the relation between:
1) applied force and pressure.
2) surface area of contact and pressure.

Answers

realtion between applied force.and pressure is more force exerts more pressure whereas less force exerts less pressure

confused in another one

Answer:

See below

Explanation:

1) Applied Force and Pressure

Pressure = Force / Area

This shows that Applied force and pressure are in direct relationship. This means that If the Applied force is more, the Pressure is also More and vice versa.

2) Surface Area of Contact and Pressure

Pressure = Force / Surface Area of Contact

This shows that Pressure and Surface area of contact are inversely related. This means that if pressure is increased on an object, the surface area of contact decreases and vice versa.

¿Por qué una persona situada debajo de las ramas de un árbol ve caer una hoja con diferente tipo de movimiento que una persona que corre cerca del árbol?

Answers

Answer:

Therefore the laws of physics are the same for the two observers, whoever is standing under the tree observes a vertical movement of free fall.

The person who is running observes a movement parabolic

Explanation:

To answer this question we must establish that as two people have inertial reference systems from which to make their observations, the inertial systems are systems with constant velocity.

Therefore the laws of physics are the same for the two observers, whoever is standing under the tree observes a vertical movement of free fall.

The person who is running observes a movement parabolic composed of the vertical movement and horizontal movement ladies go running, therefore it is a parabolic movement

Traslate

Para responder eta pregunta debemos establecer que as dos personas tiene sistema de referencia inerciales de des donde realizar sus observación, los sistema inerciales son sistema con velocidad constante.

Por lo tanto las leyes de la fisica son la misma para los dos observadores, el que esta parado bajo el árbol observa un movimiento vertical de caída libre.

La persona que va corriendo observa un movimiento compuesto por el movimiento vertical y damas movimiento horizontal ir corriendo, por lo cual es un movimiento parabólico

A 0.149 kg glider is moving to the right on a frictionless, horizontal air track with a speed of 0.710 m/s . It has a head-on collision with a 0.308 kg glider that is moving to the left with a speed of 2.27 m/s . Suppose the collision is elastic.1. Find the magnitude of the final velocity of the 0.157kg glider.
2. Find the magnitude of the final velocity of the 0.306kg glider.

Answers

Answer:

v1 = −2.201946 m/s ( to the left)

v2 = 0.7780534 m/s ( to the right)

Explanation:

Given the following :

Mass of first glider (m1) = 0.149kg

Initial Speed of first glider (u1) = 0.710 m/s

Mass of second glider (m2) = 0.308kg

Initial Speed of second glider (u2) = 2.27m/s

For elastic collision:

m1u1 + mu2u2 = m1v1 + m2v2

Where V1 and v2 = final velocities if the body after collision.

Taking right as positive ; left as negative

u1 = 0.710m/s ; u2 = - 2.27m/s

u1 - u2 = - (v1 - v2)

0.710 - - 2.27 = - v1 + v2

v2 - v1 = 2.98 - - - - (1)

From:

m1u1 + mu2u2 = m1v1 + m2v2

(0.149 * 0.710) + ( 0.308 * - 2.27) = (0.149 * v1) + (0.308 * v2)

0.10579 + (-0.69916) = 0.149 v1 + 0.308v2

−0.59337 = 0.149 v1 + 0.308v2

Dividing both sides by 0.149

v1 + 2.067v2 = −0.59337 - - - - - (2)

From (1)

v2 = 2.98 + v1

v1 + 2.067(2.98 + v1) = −0.59337

v1 + 6.16 + 2.067v1 = −0.59337

3.067v1 = −0.59337 - 6.16

3.067v1 = −6.75337

v1 = −6.75337 / 3.067

v1 = −2.201946 m/s ( to the left)

From v2 = 2.98 + v1

v2 = 2.98 + (-2.201946)

v2 = 0.7780534 m/s ( to the right)

Light, heat, electricity, sound are examples of

Answers

Answer: Energy

Explanation: Light, heat, electricity, sound are examples of energy

Light, heat, electricity, and sound are all examples of energy.

Comic-strip hero Superman meets an asteroid in outer space and hurls it at 800 m/s, as fast as a bullet. The asteroid is a thousand times more massive than Superman. In the strip, Superman is seen at rest after the throw. Taking physics into account, what would be his recoil speed (in km/s)?

Answers

Answer:

800km/s

Explanation:

Initial momentum = final momentum

the total momentum is zero, Before the release of the asteroid , but Superman and the asteroid are not moving.

So, according to the Conservation of momentum the total momentum when the astronaut is been thrown will equals to zero . Then we can say

Initial momentum = final momentum

Because the momentum of the Superman immediately the asteroid is been thrown is equal to the momentum of the asteroid

Momentum =(mass ×velocity)

the mass of the asteroid i= 1000M

Given velocity = 800 m/s,

momentum =(1000M)(800 m/s)

= 800,000M m/s.

to get the answer, we need to divide by Superman's mass, M, which gives his recoil velocity of 800,000 m/s.

But we're told to convert to km/ s

We know that 1m/s=0.001km/s

=(800,000M m/s)× (0.001km/s)

=800km/s

Therefore, his recoil speed (in km/s) is 800km/s

what does the area under a distance-time graph signify?

Answers

Explanation:

The area under a displacement vs time graph is the absement.

What did Bohr's model of the atom include that Rutherford's model did not have?
a nucleus
energy levels
electron clouds
smaller particles

Answers

Answer:

The correct option is energy levels

Explanation:

Rutherford's model of an atom suggests that an atom has a tiny positively charged central mass (now called the nucleus) which is surrounded by electrons (negatively charged) in a cloud-like manner.

Bohr's model went a bit further than the Rutherford's model in describing an atom by suggesting that the electrons which surrounds in the nucleus travel in fixed circular orbits. This description by Bohr was able to describe the energy levels of orbitals which assumes that smallest orbitals have the lowest energy while the largest orbitals have the highest energy.

Answer:

energy levels

hope this helped!

Explanation:

do you think distance and time are relevant terms in describing motion?

Answers

Answer:

yes

Explanation:

because motion is relevant

Answer:

Motion is mathematically defined as displacement, distance, velocity, acceleration, speed, and time. The motion of a body is recognized by adding a frame of reference to an observer and measuring the change in position of the body related to that frame with the change in time.

What is pin hole camera?

Answers

Answer:

Explanation:

Pinhole camera is a simple camera. It does not have a lens. The light passes from a hole and an inverted image is formed on the opposite side of the box.

what is SI unit System ? why has SI system been developed ? Give reasons​

Answers

Explanation:

SI is the international system of units

It was developed to express magnitudes and quantities

A fish inside the water 12cm below the surface looking up through the water sees the outside world contained in a circular horizon. If the refractive index of water is 4/3 the radius of circle is​

Answers

Answer:

13.6 cm

Explanation:

From Snell's law:

n₁ sin θ₁ = n₂ sin θ₂

In the air, n₁ = 1, and light from the horizon forms a 90° angle with the vertical, so sin θ₁ = sin 90° = 1.

Given n₂ = 4/3:

1 = 4/3 sin θ

sin θ = 3/4

If x is the radius of the circle, then sin θ is:

sin θ = x / √(x² + 12²)

sin θ = x / √(x² + 144)

Substituting:

3/4 = x / √(x² + 144)

9/16 = x² / (x² + 144)

9/16 x² + 81 = x²

81 = 7/16 x²

x ≈ 13.6

Which is one use for radioactive isotopes? sanitation architecture meteorology archaeology

Answers

Answer:

Archaeology

Explanation:

Radioisotopes are radioactive atoms of an element in which their atoms contain excess energy making them unstable. When broken down they become more stable releasing radiations.

Carbon 14 is a radioactive isotope that is used in archaeology to study and estimate the lifespan and age of organic materials such as wood, leather. Carbon 14 can be used to estimate the ages of materials up to 50000 to 60000 years.

Answer:

archaeology

Explanation:

I need help pls now ​plleeeeeeeeaaassseeeee

Answers

Answer:

[tex]r = \frac{v}{i} = v = ri \\ i = \frac{v}{r} [/tex]

A mass, M, is at rest on a frictionless surface, connected to an ideal horizontal spring that is unstretched. A person extends the spring 30 cm from equilibrium and holds it at this location by applying a 10 N force. The spring is brought back to equilibrium and the mass connected to it is now doubled to 2M. If the spring is extended back 30 cm from equilibrium, what is the necessary force applied by the person to hold the mass stationary there

Answers

Answer:

The necessary force applied by the person to hold the mass stationary there is 10 N

Explanation:

We are told that this person extends the spring 30 cm from equilibrium and holds it at this location by applying a 10 N force.

Thus, based on Hooke's law formula which is F = k Δx, we can say that the mass attached to the spring does not change the spring constant. Thus, the

same resistive spring force will still be in place and in turn, the same stretching force of 10N would still be required.

Thus;

The necessary force applied by the person to hold the mass stationary there is 10 N

The transmutation of a radioactive uranium isotope, 234/92U , into a radon isotope, 222/86Rn , involves a series of three nuclear reactions. At the end of the first reaction, a thorium isotope,230/90Th , is formed and at the end of the second reaction, a radium isotope, 226/88Ra , is formed. In both the reactions, an alpha particle is emitted. Write the balanced equations for the three successive nuclear reactions.

Answers

Answer:

See explanation below

Explanation:

234/92U--------> 230/90Th + 4/2He

230/90Th----->226/88Ra + 4/2He

There are various modes of radioactive decay. One of them is alpha decay.

Alpha decay involves the loss of an alpha particle from a nucleus. When this occurs, the mass number of the daughter nucleus is four units less than that of the parent while the atomic number of the daughter nucleus is two units less than that of its parent as shown in the equations above.

An alpha particle is akin to a helium nucleus in terms of mass and charge

An atom of unknown element Z has mass number of 39 and an atomic number of 18. How many protons and how many neutrons are in this atom? Show your work

Answers

Answer:

proton:18

neutron:39-18=21

Other Questions
When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces Find the formula for the inverse function.f(x)=2/3-4x Assume you have created a class named MyClass and that is contains a private field namedmyField and a nonstatic public method named myMethod(). Which of the following istrue?a. myMethod() has access to and can use myFieldb. myMethod() does not have access to and cannot use myFeild.c. myMethod() can use myField but cannot pass it to other methods.d. myMethod() can use myField only in myField is passed to myMethod() as aparameter.