What is the function of the serous membrane? (Be specific about what types of body cavities)

Answers

Answer 1
To transfer semen from the uterus to the finger nails
Answer 2

Answer:

Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.

Explanation:

BRAINLIEST PLZZZZZZ


Related Questions

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

Solve: -3x+1<-5
X>
X> 2
4
x<-2

Answers

The answer is X>2 :))

Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.

For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.

After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.

Answers

Answer:

Focus on the issue, not the person. ...

Be genuine rather than manipulative. ...

Empathize rather than remain detached. ...

Be flexible towards others. ...

Value yourself and your own experiences. ...

Use affirming responses.

Meet regularly. Hold regular strategy meetings for the entire team. ...

Be inclusive. ...

Be transparent, clear and concise. ...

Show some respect. ...

Recognize that being right may be wrong. ...

Use online collaboration tools.

Explanation:

''.''

How do blood types react in a transfusión ?

Answers

Answer:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Explanation:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

Answers

Answer:b

Explanation:

Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

What is heart?

Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.

The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.

Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

To learn more about heart, refer to the link below:

https://brainly.com/question/16566688

#SPJ2

Sylvester is dealing with hearing loss. The doctor informs him that his basilar membrane is damaged. What type of hearing loss is Sylvester experiencing

Answers

Cochlear Hearing Loss

Explanation:

It is the main organ of hearing and is part of your inner ear. Cochlear Damage means that all or part of your inner ear has been hurt. Damage to the cochlea typically causes permanent hearing loss. This is called sensorineural hearing loss. More commonly know as: SNHL

why are technical schools established?​

Answers

It established vocational education as acceptable training for certain future professionals who wouldn't need bachelor's degrees to do their jobs, such as plumbers, mechanics, and factory workers. They completed their training in focused vocational programs associated with high schools.

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

Answers

An eye on each side of the sagittal plate
2./ B. an eye on each side of the sagittarius plane

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Answers

the fourth one is correct
The answer is D!!!!!!!!

NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself

Answers

it’s karma police by radiohead c:
KARMA POLICE BY RADIOOOO HEADDDD
Other Questions
Andre cooks 16 cups of rice for a contest. He shares the rice equally among 7 judges.How much rice will each judge get? In those parts of equatorial Africa where the malaria parasite is most common, the sickle-cell allele constitutes 20% of the b hemoglobin alleles in the human gene pool. In the United States, the parasite that causes malaria is not present, but African-Americans whose ancestors were from equatorial Africa are present. What should be happening to the sickle-cell allele in the United States, and what should be happening to it in equatorial Africa 50 5(4.3 1.3) 0.5 How would you solve this? Which detail from Gilgamesh: A New English Version is the best example of an intervention by a supernatural force? PLEASE help thank you so much!!! take care 11. Everybody loves Mr Brown How are molecules built?BondingAtomic RaysPhase ChangesAll of these how did the enlightenment changed drama? Which one of the following is NOT a role of the President?Chief DiplomatCommander in Chief of the militaryPresident of the SenateAppoint Judges 60 POINTS In this speech writing assignment, you will research a problem, devise a solution, and persuade people to join your cause. Your purpose is to persuade your class and community to change their actions and beliefs about the problem youve identified. You will choose one of the following topics to write about:vending machines in the school cafeteriarequired school uniformsthe use of technology in school, such as e-readers, phone apps, MP3 players.free extracurricular school activities, such as running clubs, game clubs, etc.After you have chosen your topic, choose a clear position either in support of or against your topic.Write a 500-word speech in support of your position on your chosen topic. Make sure that you are using at least ONE of the persuasive techniques (logos, pathos, ethos). Remember that your position should be based on facts, not opinions. If possible, deliver your speech to your classroom, teacher, or parents to practice the public speaking strategies outlined above. Write down two social practices you like. Please answer quickly A 75 kg person climbs the 248 steps to the top of the Cape Hatteras lighthouse, a total climb of 59 m. How many Calories does he or she burn John's goal is to have more than -77minus, 7 dollars in his bank account by the end of the month. The variable ddd is the number of dollars in John's bank account at the end of the month Derrick drove 15 miles at an average rate of 30 miles per hour. Beth drove 40 miles at an average rate of 50 miles per hour. Which person drives for a longer time? Help me i don't understand this and i need a answer fast 16 What is the probability of spinning an odd number Two pounds of grapes cost $6. How many pounds of grapes cost $1? * For which part of the log cabin didpioneers use the fro?A. the door jamsB. the roofC. the window treatments