What is the evidence of variation when individuals in a population or group differ in some trait of interest

Answers

Answer 1

Answer:

When the more dominat trait starts to show up in most of the population while keeping the specis the same. This can be very benifitial to the population or harmful depending on the trait that is getting passed down.

Explanation:


Related Questions

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

Each Taxonomy (category) gets less and less specific as they go further down the list.

A. True

B. False

Answers

Answer:

B. False

Explanation:

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

Answer:

B. False

Explanation:

Taxonomy is the study of the general principles of scientific classification.

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

Which process produces genetically identical cells?

A. Meiosis

B. Mitosis

Answers

Answer:

mitosis produce genetically identical cells

Answer:

B mitosis i think .......

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

pushing a chair requires less energy than pushing than pushing a desk because

A. The surface area of the desk is larger.

B. The desk has less mass then then the chair

C. The chair has less mass then the desk

D. The chair is smaller

Answers

Answer:

c

the chair has less mass then the desk

Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits

Answers

Answer:

cultivated plant variety with its wild type variety.

Explanation:

The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.

Write mechanism of absorption​

Answers

Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)

Answer: I don't know

Explanation: i am brainless

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

A single species can feed at only one tropic level

True

False

Answers

Answer: True sorry if I’m wrong.

Explanation:

Answer:

True

Explanation:

Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.

Answers

Answer:

Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.

this type of cell is found in females and is needed for reproduction​

Answers

Answer:

egg cell

Explanation:

Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes are called ova or egg cells, and male gametes are called sperm. Gametes are haploid cells, and each cell carries only one copy of each chromosome.

Gametes is the answer❤️

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science

Answers

Answer:

Endoskeleton

Explanation:

Hope this helps!

Answer:

nerveos systum i think is tha anser

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

Answers

Answer:

D) Factories and Photosynthesis

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.

Answers

Answer:

The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.

The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.

When water warms or cools, hydrogen bonds either break or form.

Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.

Water is a versatile solvent.

Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.

Explanation:

The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.

Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.

Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.

The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.

PLEASE HELP! WILL MARK BRANLIEST!
The amount of carbon today is the exact amount that has always been on Earth. T or F

Answers

Answer:

False

Explanation:

Every time, the amount of carbon increases depending on the population that has grown on our planet. Carbon is a chemical substance that is created by human activities which are wood, coal, natural gas, gasoline, and oil, If it is burned, Carbon dioxide is released and mixing it in the air and continuously adds for as long as they keep doing it.

Thank you! ^^

Questions are in the attachments I’ll give a brainlist

Answers

menstruation

it is the shedding of endometrium layer of uterus in females

it is a cycle of 28 days and menstruation occurs in first 5 days of cycle

if female is pregnant then there ia no menstruation

Answer:

mensturation

Explanation:

if the unfertilized egg pass out of the female body then mensturation occurs but if the egg fertilized with the men's sperm the fertilized egg travels through the fallopian tube to implant itself into the uterus.And finally women is considered pregnant.

Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above

Answers

D is the answer you are looking for

Answer:

d

Explanation:

Choose the combination of factors that creates snow.

Answers

Answer:

Relative Humidity- Low

Air tempurature-cold

Air Pressure-low

Explanation:

High pressure, warm temperatures, and high humidity are  factors that creates snow.

What are the factors that create snow?

Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.

Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.

Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.

Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.

Learn more about snow, here:

https://brainly.com/question/29372094

#SPJ2

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

When and where would you expect to find the highest rate of primary productivity

Answers

Answer: Net primary productivity is the amount of gross primary productivity remaining after respiration, which is about 40 and 85 percent. Sloughs and marshes, as well as tropical rain forests, possess the highest rates of net primary productivity; deserts have the lowest.

Explanation:

I explained on the top-

The highest rate of primary productivity in terrestrial environments takes place in swamps and marshes and in tropical rainforests, and in aquatic environments it takes place in algal beds, estuaries, and reefs.  

• In ecology, primary productivity refers to the rate at which conversion of energy to organic substances takes place by the photosynthetic producers that attain energy and nutrients from the sunlight, and chemosynthetic producers that attain chemical energy via oxidation.  

• The majority of the energy assimilated by plants via the process of photosynthesis is not stored as organic substance, however, is utilized at the time of cellular respiration.  

• In the process, the organic components like proteins, carbs, and fats are dissociated to provide energy in the form of ATP for the metabolic needs of the cells.  

• The energy not utilized is stored in the tissues of the plants for future use and is known as the net primary productivity.  

• The highest net primary productivity in terrestrial environments takes place in marshes and swamps and in tropical rainforests, and in aquatic environments it takes place algal beds, estuaries, and reefs.  

These environments are mainly critical for the sustenance of global biological productivity.

To know more about:

https://brainly.com/question/14017102

State two substances which will
diffuse out of a cell:
(I already know Carbon Dioxide)

Answers

Water and Oxygen.

Hope this helps; have a great day!

what is a halflife in science?

Answers

One-half of the atomic nuclei of a radioactive sample to decay

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

What are the non-living components of an ecosystem?

Answers

Answer:

- Abiotic factors refer to non-living physical and chemical elements in the ecosystem.

- Abiotic resources are usually obtained from the lithosphere, atmosphere, and hydrosphere.

- Examples of abiotic factors are water, air, soil, sunlight, and minerals.
Other Questions
All of these are true about humanistic therapists EXCEPT that humanistic therapists: believe the path to growth includes taking immediate responsibility for one's feelings. focus more on the collective unconsciousness than conscious. attempt to reduce growth-impeding inner conflicts by providing clients with insight. believe the present and future are more important than the past. what is meant by versatility in terms of features of computer? Find mAC.Pls help me For consumers making purchases online, 60% have devices made by Apple, 85% own a smartphone, and 75% use Venmo. Also, out of the smartphone users, 80% use Venmo. Assume that having a device made by Apple and owning a smartphone are independent. A consumer who makes purchases online is selected at random, what is the probability they have an Apple device or own a smartphone (or both)? Enter your answer as a decimal to two places, and include the leading zero. For example, 0.12 would be a valid format. What is the median for this set of data?28, 32, 15, 19, 24, 26, 22, 32, 30 A department store buys 100 shirts at a cost of $2000 and sells them at a selling price of $25 each. Find the percent markup. U.S. women aged 20 or over have a mean HDL cholesterol levels of 55mg/dl with a standard deviation of 15 mg/dl. Assume that the distribution is Normal. What proportion of women have HDL below 45 mg/dl or less? Which is the word equation for photosynthesis? if you were to be president, what color would you paint the white house. please explain your answer (this is a gag) State the 4 Reasons for American entry into WW1 The tub of a washer goes into its spin-dry cycle, starting from rest and reaching an angular speed of 3.0 rev/s in 13.0 s. At this point, the person doing the laundry opens the lid, and a safety switch turns off the washer. The tub slows to rest in 12.0 s. Through how many revolutions does the tub turn during this 25 s interval *BRAINLIEST**Would anyone be willing to give a quick sketch of what this should look like? (CO 4 and 5) Create a program that will read in a list of test scores from the user and add them to a list. Ask the user in between each score if they want to continue (y/n). Display all of the scores entered and the total score at the end. Using the code below, put the code in the proper order Sample output: Welcome to the Test Score Program Add score: 88.45 Do you want to continue which of the following illustrates a reversible change a cooking corn be rusting c frying egg and the boiling water Fill in the blank with the Spanish word that best completes the following sentence.Jaime est por mucho tiempo. In a wish in the dark who is not connected to in chapter 30-33 Cual es la importancia de la carta de bolivar envida a Simn Rodriquez The compound sodium hydrogen sulfate is a strong electrolyte. Write the reaction when solid sodium hydrogen sulfate is put into water: What type of currency only has value because the government's lawworth something?Commodity moneyFiat moneyPaper moneyRepresentative money The length of an aluminium rod is 1m and the speed of sound along the rod is 5000 m per second .Find the values of f1 ad f2