What is the break-down of these words for medical terminology.
acromioclavicular
exophthalmos
onychocryptosis
somnambulism

Write the word.
Identify (write out), classify (prefix, root and/or combining form(s), suffix), and define the word parts.
Define the word.
NOTE: The definition of the word is not always the same as simply combining the definitions of the word parts. In this case, the root cellul means small cell, but the definition does not include the word small. Always look up the definition to verify that it is correct.

Samples:

Word: intracellular

Word part: -ar is a suffix (S) that means pertaining to
Word part: intra- is a prefix (P) that means within
Word part: cellul is a root (R) that means small cell
Definition of intracellular: (pertaining to) within a cell

Answers

Answer 1

Answer:

Medical terms can contain multiple root words, combining vowels etc. ... The root word is “card” which means “heart”, and the suffix meaning of ... This medical term's key parts are all roots: stern(root) – o – cleid(root) ... While proficiency in Latin is not required to learn medical terminology or ... nopqrstuvwxyz.

Explanation:


Related Questions

Would my bones desintigrate if I were to fly into the sun?

Answers

When you go to the sun,

Half of you, (the side thats facing the sun) is Insanely hot. Whilst the other side is crazy freezing cold. You would freeze to death at the same time that you would burn to a crisp. Also your body would become huge because the 50 pounds of pressure pushing on it would be gone cause your in space.

~Bee

Answer:

Most definitely, the sun is hotter than any thing you have ever known you probably would die before you hit the sun if you didn't have a suit because you'd freeze to death in space .

pls mark brainliest

Explanation:

During a follow-up visit, a female client who underwent a mastectomy presents with an infection that requires an antibiotic. She admits she has been doing some gardening. What further instructions and teaching are needed?

Answers

Answer: The further instructions and teaching that si needed by the female client is that she should WEAR GLOVES AND PROTECTIVE CLOTHINGS TO AVOID ANY INJURIES.

Explanation: Mastectomy is is a surgical procedure that involves complete or partial removal of the tissues of the breast inorder to prevent or treat breast cancer.

In the case of the scenerio presented in the question, it is imperative that the nurse tell the client or recommend that the client wear gloves gloves when doing any form of work like working in the backyard or housework inorder to prevent injuries ,these injuries that are being prevented if contracted may become infected or heal slowly.

When the client works,there is promotion of feeling of usefulness,meeting a need,sense of fulfillment,this in-turn has a positive effect on the client's ability to cope with her health condition and also boost/enhance her self esteem.

Advice should also be given to her on strict compliance to follow up visits,that is making sure that her follow up visits are frequent.however,it's is worthy to more that,all these won't help in any way to prevent untoward injury.

How can networking help you get a job

Answers

Answer:

because its about making contacts and getting advice. Also building relationships with companys.

Explanation:

In other words it's a opportunity to meet new people, get advice, or to work with new people.

Mr. Bickford did not quite qualify for the extra help low-income subsidy under the Medicare Part D Prescription Drug program and he is wondering if there is any other option he has for obtaining help with his considerable drug costs. What should you tell him?

Answers

Answer:

He could check with the manufacturers of his medications to see if they offer an assistance program to help people with limited means to obtai

Explanation:

Answer:

He could check with the manufacturers of his medications to see if they offer an assistance program to help people with limited means to obtain the medications they need. Alternatively, he could check to see whether his state has a pharmacy assistance program to help him with his expenses.

Explanation:

The technique where a person breathes in through the nose to a specifi c count and then exhales through pursed lips to double the intake count is known as a. sighing. b. deep breathing. c. meditation. d. autonomic ventilation. e. release management. 9. During autogenic training, a person a. contracts each muscle to about 70 percent of capacity. b. concentrates on feelings of warmth and heaviness

Answers

Answer:

a. sighing.

b. concentrates on feelings of warmth and heaviness

Explanation:

Critical infrastructure such as utilities and banking are which partners responsibility

Answers

Answer:

Federal government and private sector.

Explanation:

The complete question is

Critical infrastructure such as utilities and banking are which partners responsibility? A. Local government B. Federal government C. State government D. Private sector

Critical infrastructures are those assets that are necessities for the full proper functioning of a society and the economy at large.

Utilities such as water, electricity among others are provided by the government.

Banking can be provided by government and can also be provided privately.

A narcotic analgesic tablet contains 5 mg of hydrocodone bitartrate and 500 mg of aspirin. How many grams of each ingredient needed to prepare 100 tablets?

Answers

Answer:

500 mg hydrocodone

5000 mg aspirin

Explanation:

1 tablet       -> 5 mg hydrocodone

100 tablets ->x

x=(100 tablets * 5 mg hydrocodone)/1 tablet      x=500 mg hydrocodone

1 tablet       ->500 mg aspirin

100 tablets ->x

x=(100 tablets*500 mg aspirin)/1 tablet         x=5000 mg aspirin

You receive the following prescription: Jessie DeCato Age: 3 Weight: 22 lbs Acyclovir oral suspension 20mg/kg four times daily x 5 days a. How much acyclovir should be administered per dose? Hint: There are 2.2 lbs to 1 kg.

Answers

Answer:

The dose for this patient should be 800 mg per day, ie., 4000 mg in total for 5 days.

Explanation:

2.2 lbs: 1 kilogram

22 lbs: 10 kilograms

Acyclovir oral suspension 20mg/kg >> 10 kg: 200 mg

This needs to be repeated four times in a day (i.e., every 6 hours) during five days >>  

200 mg x 4 = 800 mg >>

800 mg x 5 days = 4000 mg

what is the purpose of the explanation of Benefits?

Answers

What explanation of benefits is is that

What is the most empathetic statements to a patient who is dying?

Answers

Answer:

Everything happens for a reason.”

Just look on the bright side

God has a plan.

I know how you feel.

He’s or She in a better place now.

Something better is around the corner.

Explanation:

The most empathetic statement to a patient who is dying is "I'm sorry." The correct option is c.

How to show empathy to patients?

Empathy-based communication is extremely powerful and successful in enhancing patient trust, reducing anxiety, and enhancing health results. According to research, compassion and empathy are linked to improved medication adherence, fewer errors, fewer malpractice claims, and more patient satisfaction.

If you're at a loss for words, just make eye contact, squeeze their hand, or give them a comforting hug. Offer your assistance.

Offer your assistance with a particular activity, such as making funeral arrangements, or simply offer to hang out with you or be a shoulder to weep on.

Therefore, the correct option is c. "I'm sorry."

To learn more about empathy to patients, refer to the link:

https://brainly.com/question/30296992

#SPJ2

The question is incomplete. The complete question is given below:

What are the most empathetic statements to a patient who is dying?

a. "Don't worry."

b. "Everything will be ok."

c. "I'm sorry."

d. "You may get better."

Other Questions
The half-life of cobalt-60 is 5.26 years. If 50 grams are left after 15.78 years, how many grams were in the original sample? Please help me now plz I will mark you brainliest can someone please help me with B i already did the ones above B Everlys school is located at the midpoint between her house and the library. Find the location of her school if her house is located at (8, 1) and the library is at (-2, -5).Group of answer choices(3, -2)(5, 3)(10, 6)(6, -4) Evaluate 9 b 9b9, minus, b when b = 8b=8b, equals, 8. what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Which statement is the correct solution?