what is photo synthesis?​

Answers

Answer 1

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer 2

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical


Related Questions

NO LINKS PLEASE

Why are there always more producers than consumers in an ecosystem?

O A. Plants do not carry out enough photosynthesis to supply the needed oxygen to primary consumers.

O B. The Sun cannot supply enough energy to support many predators.

O C. Energy is lost in food chains so many secondary consumers cannot be supported.

OD. Many consumers would contribute too much carbon dioxide to the carbon cycle.

Answers

Answer:

energy is lost in the food chains so many secondary consumers cannot be supported

48. How do matter and energy differ within a
community? Use the words recycle, trophic level,
and flow in your answer. (2.4-2.6)

Answers

Answer:

47.. in this case , the longer the food chain , the less energy is available for the rest of the members of the food chain. this indicates that a food chain with 15 trophic levels contain an energy that is insufficient to sustain all its members

48...Matter is cycled through the ecosystem in the biogeochemical cycles. ... However, energy is not recycled, but it flows into the ecosystem through the feeding relationships between the organisms in different trophic levels.

49.. (a) ...Urban development can magnify the risk of environmental hazards such as flash flooding. Pollution and physical barriers to root growth promote loss of urban tree cover. Animal populations are inhibited by toxic substances, vehicles, and the loss of habitat and food sources.

Explanation:

❣️(◍Jess bregoli◍)❣️

#keep learning!!

HELP ME PLEASEEEE:(((

Answers

Answer:

C. Red

Explanation:

Red colour on the map shows the Mid Atlantic Ridge. The Mid-Atlantic Ridge  is also called as a mid-ocean ridge. It is an underwater mountain system formed due to plate tectonics. It is created due to a divergent plate boundary that started from 87° N about 333 km to the south of the North Pole which is 54 °S, which is north of the coast of Antarctica. In the picture, the red colour is the line that shows Mid Atlantic Ridge.

Why do animals that are active at night tend to have trouble seeing in color?

Answers

Nocturnal animals have more rod cells in their eyes as compared to humans and other animals active during the day. These rod cells serve as light receptors and help them see in dim light.

The kidneys are organs that are involved in which process in mammals?

Answers

Answer: The urinary system

Explanation:

Answer:

Kidneys regulate the osmotic pressure of a mammal's blood through extensive filtration and purification, in a process known as osmoregulation. Kidneys filter the blood; urine is the filtrate that eliminates waste from the body via the ureter into the bladder.

Explanation:

3 things that you learned about Particle Theory and Wave Theory of Light

Answers

1.Particles are small
2.when I wave at the light it does not wanna wave back
3 Theories are smart guesses

How long does it take the moon to rotate on its axis?


about 25.3 days


about 27.3 days


about 30 days


about 2 months

Answers

Answer:

27.3 days

Explanation:

The Moon takes 27.3 days to rotate on its axis as the Moon takes 29.5 days to revolve around the Earth. So, the correct option is B.

What is Rotation?

Rotation is defined as the circular movement of an object around a central axis where a two-dimensional rotating object has only one possible central axis and can rotate in a clockwise or counterclockwise direction, while a three-dimensional object has an infinite number of possible centers that is axes and rotational directions.

The Moon orbits the Earth in the same direction, completing one orbit relative to the vernal equinox and the stars in about 27.32 days while one orbit relative to the Sun takes about 29.53 days.

Thus, the Moon takes 27.3 days to rotate on its axis. So, the correct option is B.

Learn more about Rotation, here:

https://brainly.com/question/15672596

#SPJ6

2. The movement of tectonic plates and the cycling of Earth materials are
the direct result of which of the following *

Nuclear fisson
Solar radiation
Thermal convection
Magnetic attraction

Answers

Answer :

Thermal convection

Explanation :

The heat from radioactive processes within the planet's interior causes the plates to move, sometimes toward and sometimes away from each other.

Answer:

Thermal Convection

Explanation:

Just trust me, it was on my quiz for stemscopes.

Does anyone know this?

Answers

The answer is C. Zygote blastocyst embryo fetus

Answer: The correct answer is zygote...blastocyst...embryo...fetus.

Explanation:

The zygote is the single cell that was the result of fertilization.

The blastocyst is the big ball of cells that was the result of differentiation and mitosis.

Then comes the embryo, and then finally, the fetus.

Good Luck <3

What is the microscopic nature of a cell ?

Why nucleus is said to be the controller of cellular activities ?

How is a cell adapted to its small size?​

Answers

Answer:

No 1 answer They require sophiscated tools. The microscopes help in the study of cells. The molecular study of the cells are performed by the help of electron microscope. So, we can say that cells are microscopic in nature.

Explanation:

No 2 answer The nucleus is the largest and most prominent of a cell's organelles (Figure 3.7). The nucleus is generally considered the control center of the cell because it stores all of the genetic instructions for manufacturing proteins.

No 3 answer Smaller single-celled organisms have a high surface area to volume ratio, which allows them to rely on oxygen and material diffusing into the cell (and wastes diffusing out) in order to survive. The higher the surface area to volume ratio they have, the more effective this process can be.

Explain the difference in How the tree and the fox get carbohydrates to use for energy

Answers

Hey Hey!

Hmm... This seems to be a simple questions. Plants/trees actually make their own carbohydrates through photosynthesis. A fox simply eats food and that is their carbohydrate source. Please mark brianliest<3!

The arrows in a food chain show: a Who eats who b Heat energy being lost c The movement of energy between organisms d The route of food to the shops

Answers

Answer:

c The movement of energy between organisms

Explanation:

Pyramid of energy is a model used to depict the flow of energy from one trophic level or feeding level to the next in an ecosystem. It's a diagram that compares the energy used by organisms at each trophic level of the food chain. The pyramid of energy must never be inverted or turned upside down.

The units used in the construction of pyramids of energy is kilocalories (kcal) or energy per area per time (Jm-²year-¹).

This ultimately implies that, the arrows in a food chain show the movement of energy between organisms such as from producers which are autotrophs or self-feeders such as plants to the tertiary consumers.

Furthermore, a list of the types of organisms in an eco pyramid are;

I. Producers: these are autotrophs or self-feeders such as plants.

II. Primary consumers: these are herbivores that typically feed on plants such as a goat or deer.

III. Secondary consumers: these consists of carnivores that typically feed or eat flesh such as lion, tiger, cheetah, etc.

IV. Tertiary consumers: these are higher predators such as humans that aren't normally fed on by other organisms in the ecosystem.

Answer: The arrows in a food chain show (The movement of energy between organisms). The correct option is C.

Explanation:

In an ecosystem, a food chain shows the transfer of energy and nutrients ( food) from organisms to organisms in a feeding pathway. Instead of giving functional group names such as primary producer, primary consumer and so on, in a good chain, the organism at each step is identified. Thus,

Grass-------> Zebra ---------> lion

(Primary (Primary ( secondary

producer). consumer) consumer)

this is an example of a simple food chain in a grassland ecosystem. This ARROWS represented above shows the direction of energy flow through an ecosystem.

Furthermore, the grass traps solar energy and stores it as chemical energy in the food made during photosynthesis. When eaten by Zebra, which is the primary consumer, the energy stored in the grass is transferred to the consumer. This transfer is inefficient as some of the stored chemical energy is lost as heat. When the zebra is eaten by a Lion,which is the secondary consumer.

A student combined equal amounts of two solutions one solution has a pH of 2 and the other has a pH of 12 which would most likely be the resulting pH? 1,3,6,11

Answers

Answer:

It would be 6

Explanation:

Because high hydrogen concentration plus high hydroxyl concentration forms a neutral solution.

plant store _____ and other essential nutrients in the vacuole

Answers

Answer:

Plant store water and other essential nutrients in the vacuole.

Explanation:

Plant store water and other essential nutrients in the vacuole.

What is herbal medicine?

Herbal medicine is defined as the medicine which is acquired from the various parts of the plants such as flowers, roots, shoots, and leaves. Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.

The main difference between herbal medicine and allopathic medicine is that the allopathic medicine is formed from the active or particular part of the plant but in herbal medicine whole plant parts are utilised.Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.

Therefore,Plant store water and other essential nutrients in the vacuole.

Learn more about plant here:

https://brainly.com/question/22167412

#SPJ2

We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True

B. False

Answers

A. True

variation of reproduction produces diverse life forms and allows organisms to evolve complex characteristics over billions of years.

Answer:

A. True

Explanation:

Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.

Which Image shows the difference between the speed of molecules in hot and cold water

Answers

Answer:

B. Because in hot water, the molecules have more energy than the molecules in cold water. This means the molecules in hot water move at a faster speed.

Explanation:

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

Part B:
Which BEST describes the result of this mutation?
A
The entire sequence of amino acids is changed.
B
The RNA strand does not code for the correct amino acids.
С
The change in amino acids shortens the polypeptide sequence.
D
The alternation of a single nucleotide encodes for a different amino acid.

Answers

Answer:

A . The entire sequence of amino acids is changed.

Explanation:

The entire sequence of amino acids is changed when the mutation occurs in the protein because amino acid is the building block from which protein is made. Mutation is the sudden change that is occur in the genetic makeup i.e. DNA when the cell is exposed to radioactive radiation of chemicals. So due to this change, the sequence of amino acids changed and they work differently.

What prevents blood from circulating backward in veins?
A.valves
B. capillaries
C. lungs
D. heart

Answers

Answer:

A.Valves

Explanation:

The pulmonary vein empties oxygen-rich blood from the lungs into the left atrium. As the atrium contracts, blood flows from your left atrium into your left ventricle through the open mitral valve. When the ventricle is full, the mitral valve shuts. This prevents blood from flowing backward into the atrium while the ventricle contracts.

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."

help pls *serious ppl only*

Answers

There is 1 white parent and 1 black parent

Match the following.

1. the energy lost to disorder
2. related to or possessing motion
3. all of the chemical reactions in an organism required for maintenance of the processes of life
4. possible; ability to go into action or perform work
5. the study of energy and its transformations

kinetic
metabolism
entropy
potential
thermodynamics

Answers

1- Entropy
2- Kinetic
3- Metabolism
4- Potential
5- Thermodynamics

1. The energy lost to disorder - [tex]\boxed{ entropy }[/tex]

2. Related to or possessing motion - [tex]\boxed{ kinetic }[/tex]

3. All of the chemical reactions in an organism required for maintenance of the processes of life - [tex]\boxed{ metabolism }[/tex]

4. Possible; ability to go into action or perform work - [tex]\boxed{ potential }[/tex]

5. The study of energy and its transformations - [tex]\boxed{ thermodynamics }[/tex]

[tex]\large\mathfrak{{\pmb{\underline{\orange{Mystique35 }}{\orange{❦}}}}}[/tex]

which of these animals did NOT benefit from the reintroduction of wolves into Yellowstone?
a. rabbits
2. bears
3. elk
4. beavers

Answers

The answer is the elk

Will give a brainiest for the answer thanks :)

Answers

Her body systems will have to work harder. Specifically, she will be breathing heavier because the muscles and organs in her body will be demanding more oxygen. Her body will also be demanding more oxygenated blood, I think. The blood will be circulating more as a result, too. Areas of the body that are working, such as her running legs, will have more blood circulating to them I believe. There is more blood flow to your heart, too.

11. When cold temperatures are produced in a chemical reaction, the reaction is
known as
a. exothermic.
b. endothermic.
c. suspension

Answers

Answer:

it's known as endothermic reaction

What is the function of chloroplasts found in the cells of plant leaves?

Answers

Answer:

A

Explanation:

Chloroplasts are cells found in the chlorophyll pigment of leaves and helps in the process of photosynthesis, allowing leaves to make food from the plant.

Which of the following shows the stage of mitosis in the correct order?​

Answers

answer: B !

hope this helps! please mark me as brainliest :)

Prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis is the correct order of mitosis. Therefore, option (B) is correct.

Mitosis is a cellular process that ensures the accurate division of a cell's genetic material into two identical daughter cells. It consists of several distinct phases that occur in a specific order.

Interphase: The cell prepares for division by growing, duplicating its DNA, and synthesizing necessary proteins.

Prophase: Chromatin condenses into visible chromosomes, the nuclear membrane disintegrates, and spindle fibers form.

Metaphase: Chromosomes align at the center of the cell, known as the metaphase plate, and attach to spindle fibers at their centromeres.

Anaphase: Sister chromatids separate and are pulled to opposite ends of the cell by the spindle fibers.

Telophase: Chromosomes reach the opposite poles of the cell, and new nuclear membranes form around them. The chromosomes begin to decondense.

Cytokinesis: The cytoplasm divides, leading to the formation of two distinct daughter cells, each containing a complete set of chromosomes.

Learn more about mitosis, here:

https://brainly.com/question/31626745

#SPJ2

The
store(s) more carbon than the atmosphere.
O rock
trees
oceans
Osoil

Answers

Answer:

Oceans

The oceans are a massive carbon sink, and part of the positive reinforcement of the greenhouse gas cycle is that, as the oceans become warmer, then tend to release more carbon dioxide dissolved in the water which in turn drives temperatures warmer.

Which of the following is definitely true about the kingdom, Protista.
A. They always have a cell wall

B. They always have a nucleus

C. They are always unicellular

D. They are always heterotrophs

Answers

Answer:

B. They always have a nucleus

Explanation:

The organisms belonging to kingdom Protista are single-celled- means they are unicellular and they have a well-defined nucleus enclosed in a nuclear membrane. Hence, they are eukaryotes. So the correct option is B.

Answer:

B. They always have a nucleus

Explanation:

Protista always has a nucleus. So, option (B) is the correct answer.

How does the skin regulate body temperature?

Group of answer choices

by increasing sweat production

by producing vitamin D

by retaining water

by regulating fat content in the epidermis

Answers

Increasing sweat production

How does the skin regulate body temperature?

[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Answer.}}}}}∘[/tex]

A. by increasing sweat production. ✔

Explanation:-

The sweat glands present in the skin helps to cool the skin as it produces sweat.Sweat glands keeps the body temperature at approximately 37° C by releasing sweat in a hot environment or during physical exertion.

[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]

Other Questions
what caused the earth to separate into layers WILL GIVE BRAINIEST ONLY IF YOU GET IT RIGHT!!!! Davenport Inc. offers a new employee two options. First, the employee can receive a one-time signing bonus at the date of employment. Second, the employee can take $31,000 at the date of employment and another $58,000 three years later. Assuming the employee's time value of money is 7% annually, what single payment in the first option would be equal to the total of the payments in the second option Please help me! I will give you Brainlist if you get it right! a mass hanged on a spring scale. what is the force exerted by gravity on 700g ? Is anyone on here good with English 9B? If you are please respond to this, I have a couple of questions PLZ HELP SOMEBODY Given the following triangle with the indicated height and base. Write and simplify an expression for the area of the triangle. Justify your answer with the appropriate formulas and calculations. Find a value of that is less than 6 for which the base, height, and area of the triangle are all positive. Each side of a square is (7 + 3x) units. Which is the perimeter of the square? How quickly did people respond to assist the injured after the bombing in Oklahoma City?It was immediate.It was the next day.It took days.It took weeks. which ancient African Kingdom was located in western Africa? 3x+2y=4 and -2x+2y=24 What is the equation of the line What is the difference between a counselor and a social worker? In 2016, David Hay started his own business, Hays Gardening and Landscapes. David was previously an employer of another business/a) What was the opportunity costs for David when he started his business?A. Cost of marketing to attract customers.B. Loss of earnings from employmentC. Payment of taxes on profitsD. Risk of business failureANSWER:b) Explain why this answer is correct? Compound A reacts with alcoholic KOH to yield compound B which on ozonolyzises followed by the reaction with Zn/H2O gives methanal and propanal Compound A is The total magnification produced from a 15x ocular and a 4x objective would be Find the value of x. Helppop!!A car and van are driving on a highway. The table shows the amount y (in gallons) of gas in the cars gas tank after driving x miles. The amount of gas in the vans gas tank after driving x miles is represented by the equation y=- 1/5x + 31. Which vehicle uses less gasoline per mile? How many miles must the vehicles travel for the amount of gas in each tank to be the same? A 2.0-in-thick slab is 10.0 in wide and 12.0 ft long. Thickness is to be reduced in three steps in a hot rolling operation. Each step will reduce the slab to 75% of its previous thickness. It is expected that for this metal and reduction, the slab will widen by 3% in each step. If the entry speed of the slab in the first step is 40 ft/min, and roll speed is the same for the three steps, determine: (a) length and (b) exit velocity of the slab after the final reduction find the additive inverse and multiplicative inverse of a 5