What is osmoregulation?

Answers

Answer 1

Answer:

adalah penghijauwan kota

Answer 2
Osmoregulation is the active regulation of the osmotic pressure of an organism's body fluids, detected by osmoreceptors, to maintain the homeostasis of the organism's water content; that is, it maintains the fluid balance and the concentration of electrolytes (salts in solution which in this case is represented by body fluid) to keep the body fluids from becoming too diluted or concentrated. Osmotic pressure is a measure of the tendency of water to move into one solution from another by osmosis.[1] The higher the osmotic pressure of a solution, the more water tends to move into it. Pressure must be exerted on the hypertonic side of a selectively permeable membrane to prevent diffusion of water by osmosis from the side containing pure water.

Organisms in aquatic and terrestrial environments must maintain the right concentration of solutes and amount of water in their body fluids; this involves excretion (getting rid of metabolic nitrogen wastes and other substances such as hormones that would be toxic if allowed to accumulate in the blood) through organs such as the skin and the kidneys.

Related Questions

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

Why might Ponyboy have idolized Pual Newman?

Answers

Ponyboy might have idolized Paul Newman because Paul Newman played many rebellious characters who Ponyboy could relate to. Some characters he played were “Fast Eddie” in The Hustler and a Southern chain gang member in Cool Hand Luke.

What do call the study of animals​

Answers

Answer:

Zoology

Explanation:

It is the study of animals, a complex discipline that draws upon a diverse body of scientific observation and theory. It can be broken down into numerous sub-disciplines: ornithology (the study of birds), primatology (the study of primates), ichthyology (the study of fish), and entomology (the study of insects), to name a few. As a whole, zoology encompasses a fascinating and important body of knowledge that enables us to better understand animals, wildlife, our environment, and ourselves

Answer:

zoology!

Explanation:

Zoology (/zoʊˈɒlədʒi/) is the branch of biology that studies the animal kingdom, including the structure, embryology, evolution, classification, habits, and distribution of all animals, both living and extinct, and how they interact with their ecosystems.

brainliest?

!!pls help!!

taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?

A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores

Answers

the answer is D) herbivores

Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.

What do you mean by herbivores?

A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.

Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.

Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.

Learn more about herbivores:

https://brainly.com/question/16786804

#SPJ2

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Which is the source of energy, which drives the water cycle?

Answers

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

Why are there more producers than nutrients? (In an ecosystem, more specifically, regarding trophic levels.)

Answers

Explanation:

any step in a nutritive series, or food chain, of an ecosystem dead organisms and waste materials into nutrients usable by the producers

Help me ASAP! CORRECT ME IF AM WRONG TY BOYS AND GIRLS

Answers

Answer:

CORRECT

Explanation:

Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?

Answers

Answer:

3.5264 x [tex]10^{7}[/tex]

Explanation:

The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.

In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.

So the short ton produced will be

= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102

= 3.5264 x [tex]10^{7}[/tex] short ton.

Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.

Which statements accurately describe fermentation? Select two options.

Oxygen is present during this process.
Cells may convert pyruvic acid to lactic acid.
NAD+ is converted to NADH.
Fermentation is an anaerobic process.
Additional ATP is produced after glycolysis.

Answers

Answer:

The answers are the second and fourth ones.

Explanation:

I did the assignment.

The statements that accurately describe fermentation are cells may convert pyruvic acid to lactic acid, and fermentation is an anaerobic process. The correct options are B and D.

What is fermentation?

Fermentation is an anaerobic chemical process that breaks down molecules like glucose. More specifically, fermentation is the bubbling that happens during the creation of wine and beer, a procedure that has been around for at least 10,000 years.

It is different from aerobic respiration because it occurs in the absence of oxygen and aerobic respiration occurs in the presence of oxygen. The product of fermentation is lactic acid, which is produced from pyruvic acid.

Thus, the correct options are: B, Cells may convert pyruvic acid to lactic acid, and D, Fermentation is an anaerobic process.

To learn more about fermentation, refer to the link:

https://brainly.com/question/14525128

#SPJ6

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element

Answers

element. an element is when a substance only contains one type of atom. compound is made of 2 or more

:-) :-) :-) :-) :-) :-) :-) :-) :-)

Please help

Answers

Answer:

B

Explanation:

sorry if im wrong!!!

In three to four sentences, explain the mpact of the spread of Middle Age culture had on ts esstern neightors

Answers


There is one word to describe the culture in the Middle Ages and that is barbaric. While some countries were better than others at maintaining order and the education of their society it was quite a rough time to exist when people had little to no rights.

PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS

Answers

Answer:The answer is the person and the tennis ball :)

Explanation:

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

what was not included in john dalton's description of the atom

Answers

Answer:

Nucleus containing protons and neutrons  and electrons

Explanation:

Answer:

This is what i found-

Explanation:

The indivisibility of an atom was proved wrong: an atom can be further subdivided into protons, neutrons and electrons. However an atom is the smallest particle that takes part in chemical reactions. According to Dalton, the atoms of same element are similar in all respects.

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

Other Questions
Which sentence best describes this picture?multipurpose businessmanElla est ocupada.l est ocupado.l est ocupada.Ella eres ocupado. James Company has 1,000 shares of $10 par preferred stock, which were issued at par. It also has 25,000 shares of common stock outstanding, and its total stockholders' equity equals $500,000. The book value per common share is: Tyson is 6 feet 2 inches tall. There are 2.54 centimeters in 1 inch. What is Tyson's height in centimeters? Read the excerpt from Hemingways A Farewell to Arms.Outside it was getting dark. I asked what time the attack was to be and they said as soon as it was dark. I went back to the drivers. They were sitting in the dugout talking and when I came in they stopped. I gave them each a package of cigarettes, Macedonias, loosely packed cigarettes that spilled tobacco and needed to have the ends twisted before you smoked them. Manera lit his lighter and passed it around.What about the actions of these men exemplifies them as Hemingway heroes?They talk about the oncoming attack, clearly with a deep sense of worry for their own safety and the safety of others.They have not yet lived through a battle and are naive about the imminent danger that awaits them.They have the bond only men in battle can share, and this is related by the way they partake of the cigarettes.They act casually and go about regular business, such as smoking, while actually in grave danger. What is an appositive phrase and what is its purpose?Hi , I really need to this so I can take my sister out for ice cream - so if anybody can solve this asap it'll be appreciated ^^ Lowkey need help ASAP In one class, there are 2 of every 8 students in the class chewinggum. If there are 32 students in the class, how many students arechewing gum? Helpppp. Pleaseee. Thankssss 5x - 3 (x+3) = what to have infinitely many solutions exact value of tan 5pi/12 A bowl holds 5 cups of water. How many cups will it take to fill up the bowl? Why was Fort Ticonderoga important to the colonists? Determine the perimeter of a rectangle with a length of 6 inches and a width of 1 foot.O 14 inchesO7 inchesO 36 inchesO 18 inches List three ways that we can help our friends family members stay optimistic during this period of social distancing focus on what we can be grateful for and what we can look forward to in the future? What is the message of the text? How does it reflect the author and audience? CAN SOMEBODY HELP ME WITH THIS QUESTION PLEASE !! ? What is the name of the image below? A coordinate plane with Number of Text Messages on the x-axis and Number of Minutes Used on the y-axis, with points plotted at, (10, 20), (20, 40), (30, 60), and (40, 80).A prepaid cell phone charges a preset number of minutes to use text messaging. The graph represents y, the number of minutes used for x, the number of text messages sent and received. Is there a direct variation? Which equation represents the relationship?Yes, y = 2x.Yes, y = 20x.No, y = x + 10.No, y = x + 20. Plssssss Help!!!Aesops fables usually end with a lesson about how to act. Describe have a Greek family might tell the stories to educate their children. Use slow and steady wins the race in your description. Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5, and a drink for $2. Write an expression for the total cost of the trip to the movies. Then find the total cost.