what is one way in which energy differs form nutrients?
A. producers do not need energy
b. energy is never recycled
c. nutrients are never recycled

Answers

Answer 1

Answer:

B. Energy is never recycled.

Explanation:

Chemical nutrients and energy tend to flow in the same direction for most of an ecosystem. The big difference is that the chemical nutrients are recycled in the ecosystem while the energy is lost from the ecosystem to the universe at large. Energy in any ecosystem comes from the Sun.


Related Questions

Summarize the differences between early succession, mid-succession, and late succession?

Answers

On primary succession newly exposed or newly formed rock is colonized by living things for the first time. And in secondary succession an area that was previously occupied by living things

AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer:

what?

Explanation:

Rocky's class recently got pet turtles. When putting together the habitat, decomposers were added to
the soil, as well as some smaller organisms that turtles eat. Some students wanted to get "fake" plants
for the terrarium, but Rocky insisted that this would negatively affect the carbon and oxygen cycles.
Which of the following reasons support why Rocky is correct?
Carbon won't be removed from the air.
Photosynthesis won't occur.
The turtles won't be able to breathe.
All of these are correct.

Answers

I’m feeling that it’s D.

Answer:

D. all of these are correct

Explanation:

I so sorry if I am wrong the answer

distinguish between absorption and reabsorption in the mammalian body​

Answers

Answer:

Tubular reabsorption is the process that moves solutes and water out of the filtrate and back into your bloodstream. This process is known as reabsorption, because this is the second time they have been absorbed; the first time being when they were absorbed into the bloodstream from the digestive tract after a meal.

Explanation:

Having trouble with this textbook question. Can anyone help me out?
"You learned that the length of the cell cycle varies between cell types. Predict which of the three phases of the cell cycle varies"

Answers

Answer:

Oh well Thx that could really help

plz help me on science due today

Answers

Answer:

A

Explanation:

Wind is caused by inequal heating. As you should have learned, things expand when they get hot and contract when they get cold. So, the high pressure hot air flows into the low pressure cold air via wind.

Genetic information is stored and transmitted within.
A. nucleic acids.
B. proteins.
C. amino acids.
D. sugars.

Answers

Answer:

A. nucleic acids

Answer:

A. nucleic acids

Explanation:

Fossils and Evolution On Study Island

A team of scientists are studying three different layers of sedimentary rock to learn about a particular reptile species. In the layer of rock that is closest to the Earth's surface, the reptiles' teeth fossils are found to be short and straight. In the layer below, the reptiles' teeth fossils are found to be long and straight. In the layer below that, the reptiles' teeth fossils are found to be long and curved.


Based on this information, the reptiles today most likely have
A.
long, straight teeth.
B.
no teeth.
C.
long, curved teeth.
D.
short, straight teeth.

Answers

Answer: short, straight teeth

Explanation: study island

What is molting????????

Answers

A dragonfly in its radical final moult, metamorphosing from an aquatic nymph to a winged adult.

In biology, moulting (British English), or molting (American English), also known as sloughing, shedding, or in many invertebrates, ecdysis, is the manner in which an animal routinely casts off a part of its body (often, but not always, an outer layer or covering), either at specific times of the year, or at specific points in its life cycle.

Moulting can involve shedding the epidermis (skin), pelage (hair, feathers, fur, wool), or other external layer. In some groups, other body parts may be shed, for example, wings in some insects or the entire exoskeleton in arthropods.

An airplane flies from Minneapolis to Chicago in 62 minutes.
If it is 572,000 meters from Minneapolis to Chicago, what is the plane's average speed?
A. 2,000 m/s
B. 355 m/s
C. 154 m/s
D. 119 m/s

Answers

Answer:

154m/s

Explanation:

Average speed= distance(m)/time(sec)

Distance=572,000metres

Time=62×60=3720seconds

As=572000/3720=153.76aproximately154m/s

What does uranium do to the environment

Answers

Uranium in air exists as dust that will fall into surface water, on plants or on soils through settling or rainfall causing it to harm humans and animals . If you inhale uranium there is a chance you can get lung cancer

Why do your mitochondria come from your mom?

Answers

Answer:

the mitochondria in mammalian sperm are usually destroyed by the egg cell after fertilization.

Explanation:

In subduction what plate would be on top and what plate would be on the bottom?

Answers

Answer:

oceanic plate would slide under the continental plate

Explanation:

continental is on top, oceanic on bottom

Answer:

When an oceanic lithosphere meets a continental lithosphere in a subduction zone, the oceanic plate always goes under the continental plate. This is the rule because the rock making up an oceanic lithosphere is denser than in a continental lithosphere.२०२० मे

How do B cells know when to make antibodies?

A.) They are alerted by Helper T cells.

B.) They are always making antibodies just in case that pathogen is present.

C.) They are alerted by Macrophages.

D.) B cells will simply find the pathogen in the body and immediately begin making
antibodies to fight the pathogen.

Answers

Answer:

A) They are alerted by Helper T cells.

necesito hacer una infografia en mi computadora y nose como pueden ayudarme

Answers

Answer:

Identify the audience for your infographic.

Collect your content and relevant data.

Choose your desired infographic template.

Download your template to PowerPoint.

Customize your infographic.

Include a footer with your sources and logo.

Add an embed code and Pinterest button, and publish it.

Explanation:

What is the answer pleaseeee

Answers

Answer: c

Explanation:

Which species has the MOST RECENT common ancestor with the ROBIN?
Hagfish
(outgroup)
Salmon
Jaws
Frog
Keratinous
scales
Lizard
Lungs:
Four limbs
Alligator
D
Gizzard
Feathers
Claws
Robin
or nails
G
Rat
Fur;
Mammary
Glands
Gorilla
Time
O Lizard
O Salmon
O Gorilla

Answers

Answer is lizard :)!

Choose the mutation that you think has caused Calix’s calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data. ( Ya'll i need a hypothesis )

Answers

The complete question is as follows:

Hypothesis Cas More Information: Here is a summary of the data, Mass of DNA Cat Res per Coll Mother Father Calix 1520 fg 1495 fg 1535 fg . The mass of an X chromosome is 40 fg. • Point mutations do not change the mass of DNA. • In chromosomal rearrangement, some daughter cells gain parts of chromosomes and some lose parts of chromosomes. • In nondisjunction, daughter cells gain a whole entire chromosome. Obe Exp Нур 는 Exp Point Mutation in Melosis Chromosomal Rearrangement Nondisjunction Choose the mutation that you think has caused Calix's calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data.

Answer:

The correct answer is - non-disjunction.

Explanation:

Calix's calico has an X chromosome gene that determines the color of fur. One allele forms orange fur and the other give rise to black. In heterozygous give rise to orange patches on black.

Mother has autosome and 2-X chromosomes.

Mass of 2 X chromosomes will be

= 40*2

= 80fg

So mass of autosomes = 1520-80

= 1440fg

Mass of sex chromosomes in father is = 1495-1440

= 55fg

So the mass of Y=55-40

= 15fg

It is clear that the mass of DNA of Calix is exactly 15 more than DNA of the mother. So we can say that Calix has an entire Y chromosome in extra.

So the answer is non-disjunction.

The right option is - non-disjunction.

Information regarding Calix’s calico:

It comprises of X chromosome gene that measured the fur color. In the case of heterozygous, it provides the increment with respect to orange that patches on black.

Since Mother has autosome and 2-X chromosomes.

So,

Mass of 2 X chromosomes should be

= 40*2

= 80fg

Now

The mass of autosomes should be

= 1520 - 80

= 1440fg

Now

Mass of s-ex chromosomes in father should be

= 1495-1440

= 55fg

Now finally the mass of Y is

= 55 - 40

= 15fg

Based on the above calculation, the mass of DNA of Calix should be 15 i.e. more than the DNA of the mother.

Learn more about the mutation here: https://brainly.com/question/8334911

help asap please!
science
Complete the table below to show the difference between active and passive transport. Put a “X” in boxes that satisfy the statement.

Answers

Answer:

Active transport:

requires energymolecules move from low to high concentration sidesNa+ and K+ move by active transport

Simple diffusion:

molecules move from high to low concentration sidesmolecules pass between lipids small non-polar and polar molecules

Facilitated diffusion:

molecules move from high to low concentration sidesinvolves channel proteinsmove large molecules

Explanation:  

Simple Diffusion is the pathway of only small molecules that freely move through the membrane by momentary openings produced by the lipids' movements. Diffusion is a slow process that requires short distances and pronounced concentration gradients to be efficient. An example of diffusion is osmosis by which water is the transported molecule. Facilitated diffusion is the transport of hydrophilic molecules that can not freely cross the membrane. Channel protein and many carrier proteins are in charge of this transport. When uncharged molecules cross the membrane, they do it according to their concentration gradients, going from the more concentrated side to the lower concentrated one. When ions need to cross the membrane, the process depends on an electrochemical gradient.  Glucose is an example of a hydrophilic protein that gets into the cell by facilitated diffusion.

Simple diffusion and facilitated diffusion are both passive transport processes because they only depend on electrochemical gradients, so they do not need any energy to occur.

Active transport is the transport of molecules that move against the electrochemical gradient, so it does need energy to happen. Molecules move from the lower concentration side to the higher concentration side of the membrane. Carrier proteins are in charge of active transport. The needed energy might proceed from the ATP molecules or the membrane's electric potential. An example of molecules moved by active transport are the Na and K.

In Active transport, molecules or ions move against the concentration gradient by using energy from ATP.

What is Membrane transport?

The transfer of molecules across the plasma membrane into or out of the cell.

There are two types of membrane transport,

1. Passive transport:

When molecules move along the gradient. It can be of two types,

Simple diffusion (via phospholipids)Facilitated diffusion (via channel protein)

2. Active transport:

When molecules move against the concentration gradient, they require energy. Energy is given by ATP.

Therefore, in Active transport, molecules or ions move against the concentration gradient by using energy from ATP.

Learn more about Membrane transport:

https://brainly.com/question/13220002

Protein in your diet provide what necessary substances to repair muscles?

Answers

The muscle damage initiates a repair process in which certain hormones, along with the macronutrient protein, synthesize new satellite cells, which are used to repair the damaged muscle fibers. In other words, the role of protein is to help repair tissues damaged by exercise.

Please help me. Thank you :()

Answers

1. Complete dominance
2. Incomplete dominance
3. Codominance

Vascular resistance is due to friction between blood and the walls of the blood vessel. Which of the following causes low vascular resistance?


obesity


dehydration


high blood pressure


cholesterol levels within normal range

Answers

Answer:

Cholesterol levels within normal range

Explanation:

Vascular resistance is due to friction between the blood and the walls of the blood vessel, and cholesterol levels within the normal range can cause low vascular resistance, which is the last option.

What is vascular resistance?

Vascular resistance is the resistance to blood flow in the blood vessels, which is determined by the diameter of the blood vessels, blood viscosity, and the length of the blood vessels, so when blood flows through the blood vessels, it experiences frictional forces due to the interaction between the blood and the walls of the blood vessels, obesity, dehydration, and high blood pressure can all contribute to increased vascular resistance.

Hence, the correct answer is that cholesterol levels within the normal range can cause low vascular resistance, which is the last option.

Learn more about vascular resistance here.

https://brainly.com/question/12877367

#SPJ2

All you have to do is give me some inspiration and I'll give points cause I would really like some inspiration please​

Answers

Answer:

ZOOM PLZ COME WE R BORED

MEETING ID 798 4170 2552

PASSWORD:XCNeV3

Explanation:

Wild flowers swaying in a abandoned field in the Netherlands

Hope that helps not sure what kinda inspo u were looking for

What consists of all the living organisms in an area and the
non-living aspects of the environment?
a Ecosystem
b Community
C Population

Answers

Answer:

a. Ecosystem

Explanation:

Ecosystem

An ecosystem consists of all the living things and nonliving things interacting in the same area.

why do snails like leaf litters​

Answers

Answer:

They will eat the biofilm that grows on the leaves. My snails love my oak leaf litter, as do my loaches. They eat the film off them.

Explanation:

What is the function of the DNA

Answers

Answer:the function is direction to build life

Explanation: i’m smart

Answer:

DNA is a information molecules.

It stores instructions for making other large molecules called proteins

these instructions are stored inside each of our cell.

distribution among 46 long structure called chromosomes

Why would breeders want to introduce mutations into a population?Single line text.

Short answers please

Answers

Answer:

Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability

What can occur nitrogenous bases do not pair correctly?

Answers

Answer:

Incorrectly paired nucleotides cause deformities in the secondary structure of the final dna molecule.

Explanation:

Many research studies have shown that different species may possess some of the exact same genes but show vastly different traits. How can that happen?

Answers

Answer:

Mutation can occur or the order in which these genes appear are in different order. Genetic variation can also occur.

Recycling of car batteries can help to do what to lead?​

Answers

Thanks to recycling, we barely mine lead any more. An estimated 85 percent of lead in use today goes into batteries, mostly for automobiles. And when the batteries run down, 99 percent of this lead is recycled to make new batteries.
Other Questions
The statement of cash flows (as well as the balance sheet) includes within cash the notion of cash equivalents. The FASB Accounting Standards Codification represents the single source of authoritative U.S. generally accepted accounting principles. Required: 1. Obtain the relevant authoritative literature on cash equivalents using the FASB Accounting Standards Codification at the FASB website (www.fasb.org). What is the specific seven-digit Codification citation (XXX-XX-XX) that describes the guidelines for determining what items should be deemed cash equivalents A village wishes to measure the quantity of water that is piped to a factory during a typical morning. A gauge on the water line gives the flow rate (in cubic meters per hour) at any instant. The flow rate is about 100 m3/hr at 6 am and increases steadily to about 280 m3/hr at 9 am. Using only this information, give your best estimate of the total volume of water used by the factory between 6 am and 9 am. Could someone please help me? If you know all the answers please write down what the answers are. Also, tell me how you got the answer. Will mark brainlist for the best answer for solving the equations or questions. Foreign policy has dominated American politics since the conclusion of World War II, as the United States became a world superpower. In an effort to face new international challenges, President Eisenhower began the build-up of the US nuclear arsenal; as a cheaper means of fighting the Cold War. In his farewell address, Eisenhower warned the country of the dangers of building up the military industrial complex. Today, however, the US is the world's greatest spender on the military and security affairs, despite being over twenty-seven trillion in debt. What are the real dangers that the US faces today Triangle BCD is similar to triangle FHE. Write at least three equivalentratios based on the diagram. 1/2 x 288 = ???????What is the answer? How many 1/5s are in 4 Simplify the expression 3.4(-2) + 10 Define these types of relationships (symbiosis).a. mutualism -b. commensalism-c. parasitism -d. predator/prey -e. competition - . What is a blastula?a hollow ball of cellsa hollow tube of cellsa solid ball of cellsa long sheet of cell What happen if your Adrenal Glands become overprotective of underproductive? PLEASE HELP I NEED IT TO PASS THIS CLASS 4. Which of the following did the 13th. Amendment make possible?A. Allowed sharecroppingB. Eliminated Poll TaxesC. Abolished slaveryD. Allowed Black Codes 2 Which of the gases in air are elements? Explain how you can tell. 770773 860333Airam AcevedoItzel Aacevedo How many 5/6 s are in 3? Please help as soon as possible ( please no links) An amusement park has recently been constructed along the coast, increasing automobile traffic in the area. What is the impact of the increased traffic in the area on oceans?a) Increases in fossil fuel emissions and greenhouse gasesb)Decreases in atmospheric gases and biodiversityc)Decreases in shoreline and bird migration distancesd)Increases in habitat for marine mammals and warmer water temperatures According to what we know about the importance of biodiversity and ecosystem services, which of the following statements best describes how humans should interact with tropical rainforest? Select the one answer that most accurately answers the question. View Available Hint(s) Select the one answer that most accurately answers the question. Humans can clear the rain forests and rely on the future secondary growth forests while disregarding the inhabitants. Humans can clear the rain forests and rely on the future secondary growth forests, as long as they make efforts to conserve the forests inhabitants. Humans should leave primary growth forests and their residents intact, and ensure that secondary growth forests have a chance to regrow. Humans should leave the plants within primary growth forests intact, but can hunt the residents for fo angle relationships. please help me. i will give you brainlist. if you are right though.