What is antibiotic resistance and why should we be
worried?

Answers

Answer 1

Answer: Antibiotic resistance is when bacteria develops a resistance or an immunity against antibiotics. If this evolution/adaptation becomes widespread, our healthcare system could see a mass rise in deaths due to us not being be able to effectively treat the bacteria which is causing harm.

Explanation:

I learned about this


Related Questions

What is happening to the cell in diagram B?

Answers

Answer:

Explanation:

B

Answer:E

Explanation:

Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I

Answers

Answer:

boost your immune system

Explanation:

Answer:

Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .

How can agriculture cause soil pollution?

Answers

Agriculture pollution

Explanation:

Agriculture is a main source of pollution in lake water. chemical and fertilzer

Answer:

Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution

Explanation:

hope this helps :)

Describe the process of absolute dating as it relates to igneous rock and the fossil record.

Answers

Answer:

Radiometric dating. Geologists use radiometric dating to estimate how long ago rocks formed, and to infer the ages of fossils contained within those rocks. ... When molten rock cools, forming what are called igneous rocks, radioactive atoms are trapped inside. Afterwards, they decay at a predictable rate.

What parts of the body make up the central nervous system

Answers

Answer:

brain and spinal cord

Explanation:

that's it

9. What is the difference betwen climate and weather?

Answers

Answer:

Climate is the long-term weather, like it is usually sunny in Florida,

Weather is the weather that you see every day, such as rainy.

Explanation:

Answer:

Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.

Explanation:

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

identify and explain three environmental impacts of current agricultural methods

Answers

Explanation:

It is profit making practice but it causes increased level of pathogens.

It has increased the level of chemicals in our land and water.

It has increased levels of greenhouse gases in air.

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there.  They might be wondering if there is another living thing out in space too.

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

Molecules of DNA are composed of long chains of?

Answers

two long polynucleotide chains

A DNA molecule consists of two long polynucleotide chains composed of four types of nucleotide subunits. Each of these chains is known as a DNA chain, or a DNA strand. Hydrogen bonds between the base portions of the nucleotides hold the two chains together

Molecules of DNA are composed of long chains of nucleotides.

What are nucleotides?

Nucleotides are the building blocks of DNA  and RNA adenine (A), thymine (T), guanosine (G), and Cytosine (C. In RNA, uracil (U) is present instead of thymine.

The pentose sugar is the ribose sugar in RNA and deoxyribose sugar in DNA. In deoxyribose sugar, oxygen is absent from the 3' carbon.

Phosphate groups are attached through the 5-C of pentose sugar by an ester bond. One polynucleotide chain is formed when the phosphate of one nucleotide forms a phosphodiester bond with the sugar of another nucleotide.

A double-stranded structure is formed by base pairing between nucleotides. The adenine binds to thymine by two hydrogen bonds and guanine binds to cytosine by three hydrogen bonds.

Therefore the molecules of DNA are composed of long chains of nucleotides.

Read more about nucleotides, here

https://brainly.com/question/13185536

#SPJ6

The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1)

Answers

Answer:

The no. of heterozygous carriers = 0.0392

Explanation:

From the given information:

The incidence of this recessive disorder i.e. q² = 1/2500

q² = 0.0004

q = 0.02

From Hardy Weinberg's Equilibrium.

p + q = 1; &

p² + 2pq + q² = 1

p + 0.02 = 1

p = 1 - 0.02

p = 0.98

So, the numbers of heterozygous carrier 2pq is:

= 2 × 0.98 × 0.02

= 0.0392

What type of cell is more likely to replicate and replicate faster brain cell or hair cell

Answers

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

What kind of inheritance is horse color an example of?

A. Complete dominance
B. Incomplete dominance
C. Co-dominance

Answers

i think the answer would be a , because of the certain color is more popular than an another based on the the gene but i can be completely wrong , correct me if i am :)


Which best explains the role of plants in the nitrogen cycle?

Answers

Answer:

Assimilation

Explanation:

This is how plants get nitrogen. They absorb nitrates from the soil into their roots. Then the nitrogen gets used in amino acids, nucleic acids, and chlorophyll. ... When a plant or animal dies, decomposers like fungi and bacteria turn the nitrogen back into ammonium so it can reenter the nitrogen cycle.

Plants absorb nitrogen compounds out of soil and animals can get it.

What do you call protozoa that you can see with the naked eye?

Answers

Answer:

Paramecium protozoa

Explanation:

because of their size (50-300 μ long) and the human eye can see things as small as about 100 µm and P.

Helpppppppppppppppppppppppppppppppppp

Answers

Answer:

umm i dont understand your question

Explanation:

6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.​

Answers

B) Evaporation , Unlike boiling, occurs at all temperatures

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

Is energy used or not?

Answers

Answer:

Explanation:

energy is used, everything uses energy especially living organisms

Answer:

Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.

Explanation:

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

What are gametes?

male and female reproductive organs
male and female reproductive tissues
male and female reproductive systems
male and female reproductive cells

Answers

Answer:

male and female reproductive cells

Explanation:

I hope it helps ❤❤

Answer:

the last one

Explanation:

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.

Answers

Answer:

No, because he used different soils.

Explanation:

which liquid will cause bean plants to grow faster.

He watered the plants with equal amounts of liquid and measured their height every other day.

The plants are in the same pots with different soils and placed in the same location.

Ok so last statement made the experiment wrong.

As a constant variable the soil should be the same for all plants only the liquid should change

Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.


dissolved oxygen in water

treated waste water

viruses

combined sewage overflow (CSO)

fertilizers

cleaning products

dog poop on the streets of NYC

water running over rocks


(This is 7th grade science)

Answers

I’m not sure about the rest but I think Dog poop is one

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

If water was removed from a plant's environment what would happen to the plant's glucose production?​

Answers

Answer:

It would cease

Explanation:

If water is removed from a plant's environment, the plant's glucose product will cease. This implies that the plant will stop producing glucose.

Water is an essential ingredient for the production of glucose by plants. During the process of photosynthesis, green plants manufactures their food in the presence of sunlight. The water combines with carbon dioxide to produce glucose oxygen gas using sunlight energy. Without water, this reaction will not be possible to take place. Therefore, the production of glucose stops when there is no water.
Other Questions
I want Mark best answer Calculate the Net force from the above Freebody diagram and data table. the length of a living room is 12 fert and its width is 10 1/2 feet. the length of the room is being expanded by x feet. select all the expressions that represent the area of the living room in square feet 5. Describe the effects of photons of light on an electron of the hydrogen atom Please answer the questions... I will surely mark you as the brainliest according to me :) Liza types 180 words in 3 minutes. Atthat rate, how many minutes does ittake her to type 1,260 words? plz help me i really beg of you! Answer these three please! Thank you Which of the following is equivalent to the image belowA: 6B: 8C: 12D: 64 Can anyone help solve this? Using the sentence context, determine the meaning of the word "copious" in the following example.Given that Arturo has read more than 23 books about volcanoes, his knowledge about the eruption of MountVesuvius is copious.abundantlimitedimpressive Suppose Americans working in the textile industry decide to boycott goods made in the European Union. Explain how this boycott will affect each of the following: The supply of dollars The international value of the dollar 16. Which of the Olympian gods did not spend much time on Mount Olympus? Maribel sold 20% of the cupcakes she made. If she sold 35 cupcakes, then she made how many cupcakes in all. In a basketball game Jamarcus made 15 out of 25 shots and tyrell made 32 out of 50 shots whos the better shooter 2 Which of the following effectively summarizes paragraph 2?A The orientation in space, relative to the Sun, is the causeof Earth's seasonal changes.1B There is an imaginary pole running through the center ofEarth from the North Pole to the South Pole, which is calledan axis.C We also learned that Earth's axis is tilted 23.5degrees from the perpendicular of the plane of theecliptic.D The northern hemisphere has more daylight hours. Be aware of your ____________ and express them in ________ ways. Andre purchased 1 quart of lemonadefrom a concession stand for $1.50.Which shows the rate for 6 quarts oflemonade? what is the ordered pair to y=7x-2 What is the title leader of the house of the representatives? Why is that position such a critical one regarding the nation as a whole