What is a buffer made from?

What Is A Buffer Made From?

Answers

Answer 1

A buffer is made from an acid - base conjugate pair as shown by option A

What is a buffer?

Buffers are often composed of weak acids and their conjugate bases (or weak bases and their conjugate acids). The weak acid can contribute a proton to balance any new base, whereas the conjugate base can absorb a proton to do so.

This balance between the acid and its conjugate base allows the buffer to survive pH changes. Buffers are essential in biological systems because many biochemical processes are particularly sensitive to pH changes.

Learn more about buffer:https://brainly.com/question/31847096

#SPJ1


Related Questions

Which of the following is not a clue that a chemical reaction has taken place? *
4 points
A solid is formed when two clear solutions are mixed.
A clear solution is added to a red solution, and the result is a blue solution.
A solid is added to water and bubbles form.
A pure solid is heated and turns into a pure liquid.

Answers

Answer:

A pure solid is heated and turns into a pure liquid.

Explanation:

No colour change recorded, only change of state, hence this is a physical change - physical changes I.e. change of state and temperature are not chemical reactions.

Which of the following is an example of a decomposition reaction?

Answers

Answer:

B is a decomposition reaction

The chemical equation which represents decomposition reaction is 2 NaCl[tex]\rightarrow[/tex] 2 Na + Cl₂.

What is chemical equation?

Chemical equation is a symbolic representation of a chemical reaction which is written in the form of symbols and chemical formulas.The reactants are present on the left hand side while the products are present on the right hand side.

A plus sign is present between reactants and products if they are more than one in any case and an arrow is present pointing towards the product side which indicates the direction of the reaction .There are coefficients present next to the chemical symbols and formulas .

The first chemical equation was put forth by Jean Beguin in 1615.By making use of chemical equations the direction of reaction ,state of reactants and products can be stated. In the chemical equations even the temperature to be maintained and catalyst can be mentioned.

Learn more about chemical equation,here:

https://brainly.com/question/28294176

#SPJ5

Which model best represents a pattern?
Antenne UHF
Chaum
RTG
Master
Antenne
grand gain
DAN
REMS
RAD
SAM
Chemin

Answers

Is it grand gain? Sorry, i’m not too good at this.

This reaction type occurs when different atoms in two different compounds trade places.

A) synthesis
B) decomposition
C) double replacement
D) single replacement

Answers

Your answer would be D, single replacement

Double replacement is the reaction that typically occurs when different atoms in two different compounds trade places (Option C).

What is double-replacement?

Double-replacement is a class of chemical reaction where two atoms can exchange their places to generate new combinations.

This type of chemical reaction (double-replacement reaction) is very common in nature.

In conclusion, double replacement is the reaction that typically occurs when different atoms in two different compounds trade places (Option C).

Learn more about double-replacement reaction here:

https://brainly.com/question/23918356

#SPJ2

....Which is the best classification for West Nile virus?
food-borne illness
irradiated disease
antibiotic resistant bacteria
emerging infectious disease

Answers

Answer:

D.

Explanation:

Emerging infectious disease

Answer:

d

Explanation:

emerging infectious disease

Is iron rusting a chemical reaction? Explain why or why not.

Answers

Answer: Yes- Rusting is an oxidation reaction. The iron reacts with water and oxygen to form hydrated iron(III) oxide, which we see as rust. Iron and steel rust when they come into contact with water and oxygen – both are needed for rusting to occur. Rusting is an example of a chemical change. A chemical property describes the ability of a substance to undergo a specific chemical change. A chemical property of iron is that it is capable of combining with oxygen to form iron oxide, the chemical name of rust.

Hope this helps.... Stay safe and have a Merry Christmas!!!!!!!!!!!! :D

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

. Which laboratory equipment would most likely be used for testing a substance for the presence of monosaccharides? *

Answers

Answer:

Benedict's reagent is the indicator we use to detect monosaccharides. When monosaccharides are mixed with Benedict's and heated, a color ange occurs.

Hope this helps!! :)

How many grams are there in 2.34x10^23 atoms of Cu?

Answers

Answer 1


Explanation

Because it’s 1

The mass of the 2.34 × 10²³ atoms of copper is equal to 24.68 grams.

What is Avogadro's number?

The Avogadro constant can be defined as the proportionality factor that the number of constituent particles in a sample with the amount of substance.

Avogadro’s number can be described as a dimensionless number that represents the number of entities in one mole of any substance. These elementary entities can be molecules, atoms, ions, electrons, or protons, etc.

Avogadro’s constant has a value approximately equal to 6.022 × 10²³ mol⁻¹.

Given, the number of atoms of copper = 2.34 × 10²³

The atomic mass of Cu Copper = 63.5 g/mol

So 6.022 × 10²³ atoms of Cu have mass = 63.5 g

Then 2.34 × 10²³  Cu atoms will have mass = [tex]\frac{63.5 \times 2.34 \times 10^{23}}{6.02 \times 10^{23}}[/tex] = 24.68 g

Therefore, 24.68 grams of Cu are there in 2.34 × 10²³ atoms of Cu.

Learn more about Avogadro's number, here:

brainly.com/question/11907018

#SPJ2

Which is the largest measurement? *
grams
Milligrams
Kilograms
Centigrams

Answers

Answer:

Kilograms

Explanation:

[tex]--------------------------------------------[/tex]

Microgram = 0.000001 Grams = Smallest Unit of Weight

1 ) Milligram = 0.001 Grams =

2 ) Centigram = 0.01 Grams

Decigram = 0.1 Grams

3 ) Gram = 1 Gram

Dekagram = 10 Grams

Hectogram = 100 Grams

4 ) Kilogram = 1000 Grams = Largest Unit of Weight = Answer

[tex]--------------------------------------------[/tex]

Hope this helps! <3

[tex]--------------------------------------------[/tex]

Kilograms are the largest unit among the options listed.

The metric system is a decimal-based system of measurement widely used around the world. It provides a standardized and convenient way to express measurements by utilizing prefixes that represent powers of 10.

In the metric system, the base unit for measuring mass is the gram (g). The gram is a relatively small unit, and to express larger or smaller masses, prefixes are added to the base unit. Here are some commonly used metric prefixes for mass.

The largest measurement among the options provided is kilograms (kg). Kilograms are larger units of measurement compared to grams (g), milligrams (mg), and centigrams (cg). The metric system follows a decimal-based system, where each unit is 10 times larger or smaller than the adjacent unit.

1 kilogram (kg) is equal to 1,000 grams (g), 1,000,000 milligrams (mg), and 10,000 centigrams (cg). Therefore, kilograms are the largest unit among the options listed.

Learn more about kilogram from the link given below.

https://brainly.com/question/29761698

#SPJ2

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

How many atoms are in the chemical formula shown? HCIO3

Answers

Answer:

5

Explanation:

chemical formulas show what atoms are in a molecule.  In this case there is 1 hydrogen (H), 1 chlorine (Cl), and 3 oxygens (O).  The 3 behind the oxygen is a subscript and tells us that there are 3 oxygen atoms.

Another example is H2O which as 3 atoms. 2 hydrogens (H) and 1 oxygen (O).  This formula has a subscript 2 behind the hydrogen showing that there are 2 hydrogens.

Which liquid has the weakest intermolecular forces?

Answers

Answer:

Oil- Only London Dispersion Forces (the weakest intermolecular force)

Water- London Dispersion, Dipole-Dipole, and Hydrogen Bonding

Liquid or solid water that falls to the ground is called

Answers

Precipitation is water released from clouds in the form of rain, freezing rain, sleet, snow, or hail. It is the primary connection in the water cycle that provides for the delivery of atmospheric water to the Earth. Most precipitation falls as rain.

What separates the inner planets from the outer planets in our solar system?
()Comet Belt
()Asteroid Belt
()Their differences
()Distance

Help plss!!

Answers

Answer:

the answer is B Astroid Belt

What Group would this element be in?

Answers

Answer:

Non-metals because it has 9 electrons meaning it is fluorine

Explanation:

Can't live without me, you wanna, but you can't, no, no, no
Think it's funny, but honey, can't run this show on your own
I can feel my body shake, there's only so much I can take
I'll show you how a real queen behaves, oh

Heres a song. Please Help Me WIth This Work

Answers

Ohh okay it’s nice is it a country song or a pop song or? :)

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

The __________________ is the process by which gases in the atmosphere absorb and reradiate heat.

Answers

Answer:

Greenhouse effect

Explanation:

Answer: water vapor, carbon dioxide and other gases absorb and reradiate thermal energy.

Explanation:

Most of the elements on the Periodic Table are metals.
True
False

Answers

Answer:

the answer is true

Explanation:

I hope so it is helpful to u

At 313° K, the volume of a gas is 50.0 ml. At constant pressure, what is the new volume of the
gas if the temperature is decreased to 293°K?

Answers

Answer:

46.80 ml

Explanation:

V1 =50ml

T1 =313K°

T2 = 293K°

V2 =?

V1/T1 =V2/T2

V2=V1*T2/T1

V2=50*293/313

46.80ml

What is the freezing point of neon F and C?

Answers

Answer:

-415.5°F and -246°C

Explanation:

In what way is Model A better than Model B? Model A shows the types of elements in the compound, but Model B does not. Model A shows the total number of atoms in the molecule, but Model B does not. Model A shows the three-dimensional shape of the molecule, but Model B does not. Model A shows the number of atoms of each element in the molecule, but Model B does no

Answers

Answer:the answer is c babes

Explanation:

I hope I could help y’all

Have a nice day

Or whatever day u want LMA0 it’s not up to me. Ight peace loves

Model A is better than Model B as Model A shows the three-dimensional shape of the molecule, but Model B does not. The correct option is c.

What are molecules?

The smallest particle of a substance possesses all of its physical and chemical properties. One or more atoms make up a molecule.

Knowing the molecular weights of the molecules allows us to calculate their sizes. The molecular weight of a molecule is the sum of the atomic weights of the atoms in the molecule.

The relative atomic mass of particles determines their size. Particles with a higher relative atomic mass weigh more than particles with a lower relative atomic mass. Larger atoms have heavier iotas and a larger relative atomic mass.

Therefore, the correct option is c, Model A shows the three-dimensional shape of the molecule, but Model B does not.

To learn more about molecules, refer to the link:

https://brainly.com/question/28931982

#SPJ2

20 POINTS!!
Kinetic and Potential Energy

Answers

A ball sitting on the peak of a mountain (potential) then the ball rolling down (kinetic)

Answer:

When a ball is rolled up a hill, it has potential energy that can turned into kinetic energy. The kinetic energy would be the ball rolling down the hill.

Explanation:

Hope this helps!

All of the alkaline earth metals are similar in that – they are all artificially made elements they all have similar atomic weights. they all have the same ionic charge. they all show variable valences.

Answers

Answer:

they all have the same ionic charge.

Explanation:

Alkaline earth metals are group 2 metals on the periodic table. They are divalent elements because they have two valence electrons and ionize by donating these two valence electrons. Elements in this group have the same numbers of electrons in their outermost shell of their atoms. i.e. they all have the same number of valence electrons and ionic charge.

What type of ion would radium (88Ra) become when forming an ionic compound, and what would the oxidation number be?

A) a cation with a +2 charge

B) a cation with a -2 charge

C) an anion with a +1 charge

D) an anion with a -1 charge

Answers

Answer:

The correct option is A

Explanation:

Radium is an atom with the atomic number of 88. It is a metal found in group 2 of the periodic table; meaning that it has two valence electrons in it's outermost shell. As a metal that wants to form an ionic compound, radium would have to lose these two valence electrons to become a divalent positively charged cation (Ra²⁺). Thus, the correct option is A

How much energy is required to boil 65 grams of 100°C water
And then heat the steam to 150°C?

Answers

Answer:

13598 J

Explanation:

Q = m × c × ∆T

Where;

Q = amount of energy (J)

m = mass (grams)

c = specific heat capacity

∆T = change in temperature

m = 65g, specific heat capacity of water = 4.184J/g°C, initial temperature= 100°C, final temperature = 150°C

Q = 65 × 4.184 × (150 - 100)

Q = 271.96 × 50

Q = 13598 J

Hence, 13598 J of energy is required to boil 65 grams of 100°C water and then heat the steam to 150°C.

ASAP, NO TROLLS 20 points!!!!

Answers

Answer:

1.- Chemical change

2.- Because the atoms in the image are tranformed into a new molecule

3.- Yes, it does

4.- Due to the amount of atoms are the same both in products and reagents

Explanation:

Answer:

1.- Chemical change

2.- Yes it does ,because the atoms in the image are transformed into a new molecule

3.- Yes, it does because energy is not being created or destroyed

4.- Due to the amount of atoms are the same both in products and reagents

if the mass of 3 black beans it's 0.7 what's the mass of one bean?

Answers

Answer:0.233333333

Explanation: Let me be!

Answer:

yea what that guy said is correct I'm pretty sure

Consider the compound Al(OH)3. What type of solid does it form?

Answers

Answer: crystal lattice

Explanation:

Answer:

A and the next question is c

Explanation:

Edge 2020

Other Questions
Which of the following is NOT an example of mechanical weathering?A.A large rock splits due to ice wedging. B.Oxidation causes rust on the rock. C.Moving water causes abrasion as rocks collide with one another and break apart. D.Plant roots grow in the crack of a rock. Juan read 300 pages in 5 days which reading rate is equivalent. A.150 pages in 3 days. B.120 pages in 2 days. C.105 pages in 1 day D.100 pages in 3 days The perimeter of a triangle is 65 meters. The second side is 5 meters less than the first side.The third side is 7 meters more than the first side. What is the length of each side? A ratio is a comparison of two quantities. For example, the ratio of cows to pigs on a farm could be 1 to 3. For every 1 cow, there are 3 pigs. The ratio of chocolate chips to raisins in a cookie could be 5 to 9. For every 5 chocolate chips in the cookie, there are 9 raisins. Do you notice a repeating phrase in these examples? For every is key ratio language. It tells you how much of one quantity exists in comparison to the other quantity. A ratio consists of just the numbers, not the units. If someone asked the ratio of chocolate chips to raisins in the cookie example, youd say 5 to 9. Find the area........................ NEED THIS NOW 50 brainily points and brainiest for best answerPROJECT: SPEECHHere is your goal for this assignment:Plan and give an effective speechSelect one of the following speech ideas to put the qualities of a good speaker into practice.1. Interview an interesting person, asking him or her questions you have prepared in advance. Take notes of the answers, organize and summarize the interview, and prepare a speech to give to your teacher or a friend.2. Give an autobiographical speech. Select one incident from your life that would appeal to an audience of your peers. Organize all the facts or events concerning this incident into a logical sequence.Use the outline form as a guide for preparing either speech topic.OUTLINETitle:I. Main Point:A. Subpoint: (information supporting the main point)B. Subpoint:C. Subpoint:II. Main Point:A. SubpointB. Subpoint:C. Subpoint:Modify this outline framework to meet the needs of your topic. Your subject may have from two to four main points and from two to five subpoints under each main point (but having a total of more than about 10 points will weaken your speech). You must have at least two subpoints for each main point.Practice giving your speech in front of a mirror or with a partner.If you are able, have someone record your speech so that you can also evaluate it according to the points listed below.Have your teacher or a friend evaluate your speech using the following points.Did the speaker:1. Know the subject?2. Show enthusiasm?3. Use meaningful gestures?4. Use a pleasant, expressive voice?5. Set a pleasing pace?6. Speak clearly?7. Use humor carefully?Comments:PLZ don't give me stuiped answer The Chester Company has just purchased $40,900,000 of plant and equipment that has an estimated useful life of 15 years. The expected salvage value at the end of 15 years is $4,090,000. What will the book value of this purchase (exclude all other plant and equipment) be after its third year of use? (Use FASB GAAPa) $32,720,000b) $29,448,000c) $35,446,667d) $33,538,000 When Romeo declares his love for Juliet in the balcony scene, who hears it? Write an expression that represents the difference of y and 32, plus the product of y and 412 points for the answer Beatrice threw a stone one and seven fourteenths yards. Tilly threw a stone nine fourteenths of a yard. What is a reasonable estimate of the difference between their two throws? 1 yard one and one half yards 2 yards two and one half yards 3x812x=42what is x? I'm not sure if these are correct. I Need Help Plz And Thank You And Show All Work And Steps. THIS IS DUESolve each system using the substitution method. Show all work and steps.4.5.1) 2x-5y=8x=3y-1A. Substitute the equation that is already solved for one variable into the other equation.B. Solve for the single variable in the one-variable equation.C. Substitute the result from the previous step into x=3y1 and solve for the unknown variable.D. Write the solution as an ordered pair. E. Check the solution with the equation not used in Step C. The split into Sunni and Shia divisions of Islam can be traced to help me please for brainlest The average speed of an oxygen molecule is 6.14 x 104 cm/sec at a certain temperature. What is the average speed of a CO2 molecule at the same temperature? (molar mass O2 = 31.9988; CO2 = 44.0098) I think it stinks that you lost the 20 bucks you had in your wallet.Which revised sentence uses standard English?I think it is unfortunate that you lost the 20 dollars you had in your wallet.I think it is too bad that you lost the 20 bucks you had in your wallet.I think it is a nightmare that you lost the 20 dollars you had in your wallet.I think it stinks that you lost the 20 dollars you had in your wallet. PLEASE AWNSER FAST!!!!!!!!The Book of DragonsChapter III The Deliverers of Their Country, an excerptBy E. NesbitIt all began with Effie's getting something in her eye. It hurt very much indeed, and it felt something like a red-hot sparkonly it seemed to have legs as well, and wings like a fly. Effie rubbed and criednot real crying, but the kind your eye does all by itself without your being miserable inside your mindand then she went to her father to have the thing in her eye taken out. Effie's father was a doctor, so of course he knew how to take things out of eyes.When he had gotten the thing out, he said: "This is very curious." Effie had often got things in her eye before, and her father had always seemed to think it was naturalrather tiresome and naughty perhaps, but still natural. He had never before thought it curious.Effie stood holding her handkerchief to her eye, and said: "I don't believe it's out." People always say this when they have had something in their eyes."Oh, yesit's out," said the doctor. "Here it is, on the brush. This is very interesting."Effie had never heard her father say that about anything that she had any share in. She said: "What?"The doctor carried the brush very carefully across the room, and held the point of it under his microscopethen he twisted the brass screws of the microscope, and looked through the top with one eye."Dear me," he said. "Dear, dear me! Four well-developed limbs; a long caudal appendage; five toes, unequal in lengths, almost like one of the Lacertidae, yet there are traces of wings." The creature under his eye wriggled a little in the castor oil, and he went on: "Yes; a bat-like wing. A new specimen, undoubtedly. Effie, run round to the professor and ask him to be kind enough to step in for a few minutes.""You might give me sixpence, Daddy," said Effie, "because I did bring you the new specimen. I took great care of it inside my eye, and my eye does hurt."The doctor was so pleased with the new specimen that he gave Effie a shilling, and presently the professor stepped round. He stayed to lunch, and he and the doctor quarreled very happily all the afternoon about the name and the family of the thing that had come out of Effie's eye.But at teatime another thing happened. Effie's brother Harry fished something out of his tea, which he thought at first was an earwig. He was just getting ready to drop it on the floor, and end its life in the usual way, when it shook itself in the spoonspread two wet wings, and flopped onto the tablecloth. There it sat, stroking itself with its feet and stretching its wings, and Harry said: "Why, it's a tiny newt!"The professor leaned forward before the doctor could say a word. "I'll give you half a crown for it, Harry, my lad," he said, speaking very fast; and then he picked it up carefully on his handkerchief."It is a new specimen," he said, "and finer than yours, Doctor."It was a tiny lizard, about half an inch longwith scales and wings.So now the doctor and the professor each had a specimen, and they were both very pleased. But before long these specimens began to seem less valuable. For the next morning, when the knife-boy was cleaning the doctor's boots, he suddenly dropped the brushes and the boot and the blacking, and screamed out that he was burnt.And from inside the boot came crawling a lizard as big as a kitten, with large, shiny wings."Why," said Effie, "I know what it is. It is a dragon like the one St. George killed."And Effie was right. That afternoon Towser was bitten in the garden by a dragon about the size of a rabbit, which he had tried to chase, and the next morning all the papers were full of the wonderful "winged lizards" that were appearing all over the country. The papers would not call them dragons, because, of course, no one believes in dragons nowadaysand at any rate the papers were not going to be so silly as to believe in fairy stories. At first there were only a few, but in a week or two the country was simply running alive with dragons of all sizes, and in the air you could sometimes see them as thick as a swarm of bees. They all looked alike except as to size. They were green with scales, and they had four legs and a long tail and great wings like bats' wings, only the wings were a pale, half-transparent yellow, like the gear-boxes on bicycles.Based on the rising action in the bolded paragraphs, what do we know about Daddy? (5 points)He is calm and curious.He is angry and upset.He is hysterical.He is uninterested and bored. How can the image be described? Check all that apply.smaller than the objectrealright-side uplarger than the objectupside downvirtual at the left.6.1. Work equalsA force x distanceB. force - distanceC. force + distance.The force you apply to a machineis theA. input force.B. output force.C. efficiency.2.The unit of work is theA. watt.B. newton.C. joule.7.The efficiency of all realmachines isA. greater than 100%B. equal to 100%C. less than 100%3.Power is the amount ofA. work done per unit of time.B. force on a certain area.C. pressure in a volume of liquid.8.4.The unit for power is theA. joule.B. Meter per secondC. watt.The fixed point that a lever rotatesaround is called theA. fulcrum.B. input force.C. wedge.9.5.A machine cannot change theA. direction of the input force.B. amount of work needed to doA screwdriver is an example of asimple machine called aA. pulley.B. screwC. wheel and axle.a task.C. distance over which a forceis applied10.Your front teeth areA. wedges.B. levers.C. compound machines.