What happens to the sugars that are made during photosynthesis?

Select one:
a.
They can be used for cellular respiration.
b.
They make ATP by bonding together.
c.
They go back into the Calvin cycle.
d.
They move directly into an electron transport chain.

Answers

Answer 1

Answer:

They can be used for cellular respiration

Answer 2
D. They move directly into an electron transport chain

Related Questions

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?

A)Enzymes do not affect the energy of a reaction.

B)Enzymes slow down reactions so products can form.

C)Enzymes can be reused because they do not permanently bond with substrate.

D)Enzymes can only bind to other enzymes so the same product is formed each time.

Answers

Answer: C

Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

Enzymes can be reused because they do not permanently bond with substrate.

What are Enzymes?

A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.

Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.

Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

Therefore, Enzymes can be reused because they do not permanently bond with substrate.

To learn more about Enzyme, refer to the link:

https://brainly.com/question/14953274

#SPJ6

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Drag each tile to the correct box. COOL PICS
Arrange the organisms from fastest to slowest based on the time they’d take to complete the 20th Carnegie stage.





mouse
baboon
chicken
human
sheep

Answers

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:

Which is the source of energy, which drives the water cycle?

Answers

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

Will lactase, the enzyme that digested the ice cream's lactose, also work on the lactose found in cheese?

Answers

Answer:

Yes

Explanation:

This is because lactose found in any dairy product will always have the same molecular structure. The lactase enzyme breaks down lactose because of how it is structured, so it does not matter where the lactose comes from.

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

please help i will give brainlist

Answers

Answer:

I think it's c hope I hope I helped if not I'm sorry:(

Option B is i hope
I think it is

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

What is the atomic mass of Sulfur that has 18 neutrons?

Answers

Answer:  32.066 atomic mass units

B is the correct option.

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

Can you tell me which go where?

Answers

Answer:

heredity goes to the first one

phenotype at the second one

Explanation:

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Other Questions
Help please What are the principal climatic zones in which the Incas existed?| What was the name of the first acting company Shakespeare worked? Plz help me i need it BRAINLIEST AND GOOD RATING IMMEDIATLYMarcus and Lily are running at the school track. The graphs below represent the distance in miles each person has run as function of time in minutes. Select all the statements that are true based on the graphs shown. for what value of x is d parallel to e? A) 20B) 25C) 35D) 37 a.1. Which of the following is not considered a good research question?What features do most popular national parks have in common?b. What factors have influenced population growth in the fastestgrowing countries?c. What effect do social media have on people's minds?d. What effects does daily use of Twitter have on the attention span ofunder-16s?2. All of these are ways to limit and narrow your research topic excepta. by geographical areab. by interestc. by cultured. by time frame In the 2006 season, Tom Brady threw for 3,529yards. In the 2007 season, he threw for 2,806yards. What is the percentage decrease WILL GIVE BRAINLIESTPLS HELP I DONT WANT ANYTHING TOO HARD AND SOMETHING FUN Now it's time to choose a Bible topic for your report. Go over your list and write your topic choice in the paragraph box below.My topic is: Glaciers1. Glaciers long ago helped form today's landscape in Minnesota. As glaciers melted, they formedthousands of what? (Name physical features) Write the equation of the line that passes through the point 2,-1 and has a slope of -3 HELP ME PLEASE!!!!!!!!!!!!!!!! You have to figure out whether its undefined or zero Which sentence is most clearly objective?A. During recess, we often pranked mean old Mr. Granger.B. My sister always made "plans" that fell through quickly.C. As a chess club member, I was destined for great things.D. I grew up in a small town in Illinois called Shady Glen. Describe how the plot of Of Monsters and Mazes reinterprets the myth of Theseus and the Minotaur to tell a new story. Use two details from each story in your response. Pythagorean Theorem Quiz.1.) Find the unknown side length. Simplify answers that are radicals.432.) Find the unknown side length. Simplify answers that are radicals.1612 How did the admission of territories acquired by the U.S. in the Mexican War shed light on the root issues dividing north and south for decades before the Civil War Malik has two pencils. He has four blue pencils and 2 red pencils. What is the radio of red pencils and blue pencils? What commitments were made on the issue of slavery find the slope thanks PLEASE question 25. there are many early warning signs of stress. Some of these signs are physical, somewhere emotional, and others are behavioral. For the following list, choose A if you believe the a sign and it physical one and B if you believe it is an emotional one.A. physicalB. emotional Fill in this pretty little blank.Cause ima very _____ ____ get ___ ____ ___ momma.-MulattoHit that latto Recall the educational and other requirements for Geographers. What are some requirements that would be helpful toinclude in this career plan? Check all that apply.master's degree and GISP certificationcommunication skills, including reading, writing, listening, and speakingsales skillsassociate degree, and GAST certificationleadership and supervisory skills for managing teams of other peopleanalytical and critical thinking skillscomputer skills