what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
A limiting factor is a resource or other factor in the environment that can lower the population growth rate.
A. True
B. False
The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?
Answer:
No organisms
Explanation:
This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.
Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )
Answer:
Please where's the image of the question
Answer:
B
Explanation:
Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.
People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225
A planet has less mass than a galaxy and more mass than the star it orbits.
True
False
Answer:
False is your answer
A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?
Answer:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
Explanation:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.
During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.
The fathers gene may be dominant due to environmental circumstances or other factors.
Answer:
Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.
Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea
Answer:
Yes.
Explanation:
Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.
Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.
ITS C
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron
PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!
did you get the answer
true or false
Photosynthesis is part of an oak tree's niche.
Answer:
True, veryyyyy true
:))
mushroom can only be found in dark places . why ?
Answer:
advantage of growing mushrooms in the dark is that darkness preserves the moisture that mushrooms spores need to reproduc
Which process begins the formation of sedimentary rock?
If a son has a sex-linked disorder, he received it from ______.
Answer:
tuff
Explanation:
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above
Answer:
The answer for this question is D
Which conclusion is supported by the fact that the black-breed boar, with its quality meat, and the white-breed sow, with its quality fertility, are swine that are often matched for mating? Animals are often paired based on physical traits and personal compatibility. Strong reproductive capability is the most important trait in animal breeding. Selective breeding combines ideal traits of animals to replicate in offspring. Swine are the only agricultural animal species that are currently crossbred.
Answer:
Selective breeding combines ideal traits of animals to replicate in offspring
Explanation:
Selective breeding is the process which involves choosing parents with particular characteristics to breed together and produce offspring with more desirable characteristics. It is also known as artificial breeding and provides both plants and animals with greater variation and higher chances of survival. Selective breeding can be used to produce plants with bigger and tastier fruits and vegetables, crops with greater resistance to pests and diseases, and bigger animals that can be used for meat or milk production. The process of selective breeding is of great importance to the farmer today as it has brought about greater economic advantages.
In the instance of the black-breed boar and the white-breed sow being matched for mating, the reason is to combine these desirable traits in their offspring. The black-breed boar produces quality meat while the white-breed sow has quality fertility. Mating between these two breeds will produce offspring which has both traits of quality meat production as well as quality fertility.
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?
Answer:
Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.
Explanation:
Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.
Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.
What is antigen tests?An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.
Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.
To learn more about the Antigen click here
https://brainly.com/question/14453511
Deoxyribose (sugar). Total number in image?
Answer:
Formula: C5H10O4
Molar mass: 134.13 g/mol
Solubility in water: Very soluble
Melting point: 91 °C (196 °F; 364 K)
Appearance: White solid
Classification: Pentose, Deoxy sugar
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.