What does flim shot have in common?

Answers

Answer 1

Answer:

In filmmaking and video production, a shot is a series of frames that runs for an uninterrupted period of time. Film shots are an essential aspect of a movie where angles, transitions and cuts are used to further express emotion, ideas and movement.This is one of the most common shots seen in films, as it focuses on a character (or characters) in a scene while still showing some environment.


Related Questions

Who invented the wheel? How did it change the way people did things?
Give at least 3 reasons.

Answers

Answer:

The ancient Mesopotamian people invented the wheel.

Explanation:

Ways it changed the way people did things:

1. It revolutionized the way people traveled from place to place.

2. It helps export and import goods, today and back then.

3. It allowed people to travel faster.

Hoped this helped! :)

PLEASE MARK AS BRAINLIEST!!!

it was the Mesopotamian people

the ancient Mesopotamian people are widely believed to have invented the wheel around 4200–4000 BC, It is likely to have also been invented, independently in China, around 2800 BC.

A fire drill forces everyone to leave school and stand outside, where it is
raining. Ella forgot her umbrella and got soaking wet. Which of the following
caused her to get wet?
A. The fire drill
B. The rain
C. Forgetting her umbrella
D. All of these
HINT
SUBMIT

Answers

The answer is d just answered it

How much nations existed in Africa after WW2

Answers

Explanation:

b88yvyv8h7tvpjh8y7tydf7

Depends on how long after World War II you are looking. Right after, 4 nations existed. However, there are 54 recognized states today in Africa. Hope this helps!

What social values would have led Jacques Cartier to kidnap the sons of the Iroquois host at the Gaspe Peninsula and take them to Europe?

Answers

Answer:

To prove he had made landfall on the shore of North America

Explanation:

The social values that would have led Jacques Cartier to kidnap the sons of the Iroquois host at the Gaspe Peninsula and take them to Europe are "To prove he had made landfall on the shore of North America."

During the period in which Jacques Cartier first explored North America, many explorers and voyagers had made quick money in lying about sailing to North America, whereas they only sailed out of sight and after sometimes come back to tell the unfortunate tales after pocketing their proceeds.

Hence, to prove he has reached North America and have seen people there, he kidnaps the sons of the Iroquois host at the Gaspe Peninsula and takes them to Europe

which president was on john green's chalk board

Answers

thomas jefferson was on john greens chalkboard !!

The trial of Peter Zenger is widely credited with being the first example of American freedom of?

Answers

The trial of Peter Zenger is widely credited with being the first example of American freedom of "press" and "speech", since Zenger was tried but acquitted of publishing articles in his newspaper that went against the government

Explain why the Aztecs first accepted Cortes.

Answers

The Aztecs though that Cortes was sent by god. They accepted him to keep the gods happy so they'd postpone the end of the world. While it wasn't the end of the world it would be the end of the Aztec Empire.

Answer:

The Aztecs though that Cortes was sent by god. They accepted him to keep the gods happy so they'd postpone the end of the world. While it wasn't the end of the world it would be the end of the Aztec Empire.

Explanation:

Plzzz help me...

A shoe company made a special edition basketball sneaker in a limited quantity. The sneaker sold out quickly and is
currently unavailable. Which economic concept does this scenario demonstrate?
O opportunity cost
O scarcity
nonrenewable resources
O specialization

Answers

The correct answer is B. Scarcity

How did buying stocks on credit contribute to the Great Depression?


The government stepped in and stopped stock purchases so that people could not buy more.


Banks wanted to lend people money, but people were hesitant to borrow.


Credit interest rates were too high for people to pay.


When stock prices fell, people did not have the money to cover their losses.

Answers

Buying stocks on credit contribute to the Great Depression when stock prices fell and people did not have the money to cover their losses.

What is great depression?

It was a time of great loss for American when the economy was on a decline and money was not in circulation.

Returns on shares was also on the decrease and investors where greately affected.

Therefore, Buying stocks on credit contribute to the Great Depression when stock prices fell and people did not have the money to cover their losses.

Learn more on investors below

https://brainly.com/question/1305349

#SPJ6


Which type of business grew most quickly in the United States during the late
1800s?
A. Family-owned stores
B. Employee-owned factories
C. Local farms
D. Large corporations

Answers

Answer:

Family -owned stores was the bussiness which grew most quickly in the United States during th late 1800s

Answer:

c

Explanation:

Why does Clay think that accepting Texas as a state would end up “strengthening one part
against another part of the common confederacy” and thus causing the Union to dissolve?
THIS IS A 60 POINT QUESTION AND I WILL GIVE BRAINLIEST ANSWER ASAP

Answers

Answer:

Clay believed that if Texas is be received into the Union as an integral part of it  then it will destabilize the union and instead of acquiring Texas, it is better to compose and harmonize the present union rather than introducing as new component that would further add to the existing element of discord and distraction. He said that acquisition of foreign land is not right if it is done for strengthening one part against another part of the common confederacy and this can lead to dissolution of the Union

Explanation:

Clay believed that if Texas is be received into the Union as an integral part of it  then it will destabilize the union and instead of acquiring Texas, it is better to compose and harmonize the present union rather than introducing as new component that would further add to the existing element of discord and distraction. He said that acquisition of foreign land is not right if it is done for strengthening one part against another part of the common confederacy and this can lead to dissolution of the Union

Accepting Texas as an integral part of the Union, Clay believed, would destabilize the union, and that rather than acquiring Texas, it would be better to compose and harmonize the existing union.

What was the opinion of clay about the Texas?

Clay believed that accepting Texas was an integral part of the Union would destabilize the union, and that rather than acquiring Texas.

It would be better to compose and harmonize the existing union rather than introducing a new component that would add to the existing element of discord and distraction.

He affirmed that acquiring foreign land for the aim of changing one component part of the public confederacy against some other was wrong, and that it could lead to the Union's dissolution.

Therefore, Clay believed that accepting Texas as an integral part of the Union.

Learn more about the Texas, refer to:

https://brainly.com/question/14968290

#SPJ5

Gh is pronounced ch in Middle English.

Answers

Answer:

YEAH?

Explanation:

Which of the following is NOT something that Hitler did to show his views of the Treat of Versailles and his aggressive ambitions?

Answers

Answer: D. Hitler stormed Poland, so A is out. Hitler used the money he saved from not paying reparations to build his army and navy, so that takes out B and C. On March 7th, Hitler sent forces to take back Rhineland. So that takes out E.

Who was the Strength of the Triple Alliance?

Answers

Answer:

Germany was the strongest member of the Triple Alliance, and it suffered most of the losses of the Central Powers during World War I. The Austro-Hungarian Empire was quite weak by 1914, as the different ethnic groups in it were trying to separate and form their own states.

Explanation:

The Bill of Rights was added to ensure the passing of the Constitution. The main purpose of the Bill of Rights was

O to ensure the need for no further amendments.

O to ensure the rights of the government.

O to gain support of the Federalists supporters.

O to ensure and protect individual rights.

Answers

Explanation:

O to ensure and protect individual rights.

Please help me out with this

Answers

Egypt

Death

Osiris

Mummification

Spirit

Wealthy

Ordeal

Sodium

Wrapped

Desert

I need help with this

Answers

Answer:

1. samuel

2. apprenticeship

3.hophni phinehas

4. abraham

5. israel

6. jacob

Explanation:

works very well

ano ang mahihinuha ninyo sa larawan?​

Answers

Answer:

Wala akong makitang larawan

Explanation:

how did the persian empire manage the territory it

Answers

Answer:

The Persians divided their empire into 20 provinces that were managed by governors. In addition, they provided land to feudal lords in exchange for loyalty and guarantees of soldiers for the Persian army. Most of the people in the empire, including average Persians, simply remained struggling farmers or craftspeople.

when was George Washington born​

Answers

Answer:

February 22, 1732

George Washington was born at his family's plantation on Popes Creek in Westmoreland County, Virginia, on February 22, 1732, to Augustine and Mary Ball Washington.

Answer: February 22, 1732

Explanation:

Help me please! (20 characters long)

Answers

i think the answer is B

What changes were made to Japan's political systems after the war ended? Check all that apply. A new constitution was written. Japan had the right to wage war. The emperor's power was reduced. More armed forces were created. Women were given more rights.

Answers

Answer:

A) a new constitution was written.

C) the emperors power was reduced.

E) women were given more rights.

Hope this helps! :)

Which of the Santa Fe Trail’s two routes stretched over 800 miles and traveled through the Rockies?
A.
the Oregon Route
B.
the Mountain Route
C.
the Texas Route
D.
the Cimarron Route
help please

Answers

A the Oregon route because it is 800miles and this is the correct answer

Write 1 paragraph about what your life was like during the depression if you lived in a rural area (like the Midwest). Use first-person and include specific details and statistics.

Answers

My name is Donald, I grew up as an only child during the era of the Great Depression. Before me I had two brothers, Charles and Adrian who died before I was born. My father worked as a furniture maker before the Depression. Yet, due to rough times he was forced to work for a company that built screens for homes when the Depression began. He supported my mother and me as well as several other family members.

what makes the pottery of mata ortiz a traditional art form?

Answers

Answer:

Mata Ortiz pottery is a recreation of the Mogollon pottery found in and around the archeological site of Casas Grandes (Paquimé) in the Mexican state of Chihuahua. Named after the modern town of Mata Ortiz, which is near the archeological site, the style was propagated by Juan Quezada Celado. Quezada learned on his own to recreate this ancient pottery and then went on to update it. By the mid 1970s, Quezada was selling his pottery and teaching family and friends to make it and the pottery was able to penetrate the U.S. markets thanks to efforts by Spencer MacCallum and later Walt Parks along with Mexican traders. By the 1990s, the pottery was being shown in museums and other cultural institutions and sold in fine galleries. The success of the pottery, which is sold for its aesthetic rather than its utilitarian value, has brought the town of Mata Ortiz out of poverty, with most of its population earning income from the industry, directly or indirectly.

Mata Ortiz pottery is a recreation of the Mogollon pottery found in and around the archeological site of Casas Grandes (Paquimé) in the Mexican state of Chihuahua. Named after the modern town of Mata Ortiz, which is near the archeological site, the style was propagated by Juan Quezada Celadon.

How does Juan Quezada make his pots?

Quezada makes his pieces with simple tools. The pots are initially built using the coil method, then they are scraped with a hacksaw blade to their final shape. He fires the pots in small groups in an inverted flower pot saggar, covered in cottonwood bark or cow manure which is set on fire.

Learn more about Juan Quezada here: brainly.com/question/16850954

#SPJ2

Why were Plateau Indians seminomadic?

Villages moved to remain isolated from others.
Villages moved to go south during the winter.
Villages moved to be near water supplies.
Villages moved to follow the food supply.

Answers

Answer:

Villages moved to follow the food supply.

Explanation:

Following food is a form of hunting and gathering. If they were following certain types of fruits and vegetables, they would have to set up camp to wait for them to fully ripen or grow. Being nomadic means you wander always. Never have a home. Because they had to have temporary homes to wait on growing foods, that makes them semi nomadic. They will move again to find more areas of crop.

Answer:

Villages moved to follow the food supply.

Explanation:

its D just took the test

According to the passage, what were effects of the Homestead Act? Check all that apply.

Answers

Answer:

a, c and d

Explanation:

right on edg 2022

c. How has our society been developing? Write in six​

Answers

Explanation: Development is attributed to the capacity of society to mobilise resources to resolve problems and challenges. In the course of its growth, society is going through well-defined phases. It is nomadic hunting, farming, urban, commercial , industrial and post-industrial communities in rural areas.

During his march from Atlanta to the sea, Sherman and his men destroyed anything useful to the South.

Answers

Answer:

atlanta

Explanation:

what were the goals of the french revolution? check all that apply. A. writing a constitution, B. ending absolute rule, C. lowering taxes for the rich, D. protecting individual rights, E. ending the class system​

Answers

Answer:

the answer would be D and E

Answer:

a, b, d, and e

Explanation:

i just took it and got them right

Other Questions
Which sentence correctly uses a comma to join independent clauses? The real numbers whose decimals do not end and do not repeat are (irrational numbers / rational numbers). Answer this guys please I would really appreciate if someone could answer this :) What is the degree of 1 Which detail is most important to include in a summary? Electric current is the flow of ________ through a substance. A shopper is visiting an outdoors market and finds a rug to buy. The shopper does not have a measuring tape to measure the rug. Instead, the shopper takes steps across the rug to determine the dimensions. The shopper's shoes are approximately 12 niches long. What is the estimated area f the rug? Read the excerpt from a report. (1) Stopping trash before it gets to the ocean is way better than having to clean it up in the ocean. (2) The city of Baltimore has a large machine called Mr. Trash Wheel. (3) The machine is powered by the sun and the flow of the river. (4) Floating booms off the front of the machine funnel garbage toward a conveyor belt. (5) The belt takes the garbage from the water and puts it in a dumpster. (6) The trash wheel helps collect garbage in the river after it flows out into the ocean.Which revision improves the professional tone of the text?Change sentence 1 to: Preventing garbage from entering the ocean is more effective than removing waste from the sea.Change sentence 2 to: The city of Baltimore has really cool machine called Mr. Trash Wheel.Change sentence 4 to: Floating booms and a conveyor belt help the machine work its magic.Change sentence 5 to: The belt takes a bunch of the garbage from the water and then tosses it in a dumpster. Please helpExplain two audiences groups that the movie is sustainable for a bank robbery movie? explain in two different paragraphs. What is one disadvantage of using nuclear fission to produce electricity?A. It is difficult to store and dispose of radioactive wastes.B. It produces only a small amount of energy.C. It requires very high temperatures and pressures.D. It has a limited supply of fuel.SUBMIT 5 to the power -2 * 5x is equal to 1 solve for x If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9 Describe how a jump rope can be used to model a cell membrane of a plant cell Write an equation that models the situation and find its solution.It's going to be Lindsay's birthday soon, and her friends Martin, Sylvia, Tad, and Yvonne have contributed equal amounts of money to buy her a present. They have $25.00 to spend between them. Determine how much each contributed what is the value of x to the nearest tenth? NEED HELP!! Edmentum PLATO 50 POINTS! Marketing through social media is very popular today. You have seen how mobile technology has accelerated the use of social media for marketing.Research at least three mobile marketing techniques and then write a report about a company that has used mobile marketing with success. Include the following points in your report: Describe in detail the technique used in the mobile marketing campaign.What was the campaign trying to achieve?Who was the target audience? What techniques did the company use to broaden the audience base?Describe the campaign process in detail.What results did the campaign achieve?How did mobile technology play a key role in the marketing campaign?How did mobile technology enhance the campaign compared to traditional marketing methods?Why do you think the campaign succeeded?In what ways could the company have improved the campaign?