what are the major groups of animals and how to they differ

Answers

Answer 1
There are many living things in the world. To keep them simple and easier to remember, the scientists had identify many groups of animals. The six main groups are: invertebrates, mammals, birds, amphibians, reptiles and fish.

Related Questions

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Can podocyte cells in the Bowmann capsule attach to any other basement membrane other than the glomerular basement membrane? That is, it can itself have a separate layer of base membrane?​

Answers

Answer:

"Podocytes are cells in the Bowman's capsule in the kidneys that wrap around capillaries of the glomerulus. Podocyte cells make up the epithelial lining of Bowman's capsule, the third layer through which filtration of blood takes place.[1] The Bowman's capsule filters the blood, retaining large molecules such as proteins while smaller molecules such as water, salts, and sugars are filtered as the first step in the formation of urine. Although various viscera have epithelial layers, the name visceral epithelial cells usually refers specifically to podocytes, which are specialized epithelial cells that reside in the visceral layer of the capsule. "

Explanation:

hope this helps

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

The image shows a food web in an Arctic ecosystem. Rising temperatures in the Arctic Ocean can lead to large die-offs of phytoplankton, which are autotrophs. What would most likely happen in an Arctic ecosystem if the phytoplankton population decreased?

Answers

Answer:

as the population of phytoplankton decreases, the amount of food for zooplancktons decreases

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

____is associated with deamination of protein​

Answers

Answer:

Deamination is the removal of an amino group from a molecule

Deamination is associated with deamination of protein​

Answer:

in humans , deamination  takes place primarily in the liver, it can also occur in the kidney. if there's excess protein intake , deamination is used to break down proteins with amino acids for energy

Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom. Which group of organisms has the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom? sponges roundworms annelids chordates

Answers

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

Answer:

its b

Explanation:

Technology has affected society by causing radical changes in how people live. For example, e-mail on the computer has changed the way we communicate with the world. Describe another example of how technology has changed how people live

Answers

Answer: the modern production of the cars change the way of transportation

Modern houses change the way where people locate

Another example of how technology has changed how people live is the widespread use of smartphones and mobile applications.

Smartphones have become an integral part of daily life for many people, revolutionizing the way we communicate, access information, and carry out various tasks.

Some ways in which smartphones and mobile applications have transformed our lives:

1. Communication: Smartphones have made communication more convenient and accessible. With features like instant messaging, video calls, and social media apps, people can easily connect with others regardless of their location.

2. Information Access: Smartphones provide instant access to a vast amount of information through the internet. With a few taps on a smartphone screen, people can search for news, look up facts, find directions, or access educational resources.

3. Online Shopping: E-commerce platforms and mobile shopping apps have revolutionized the way people shop. With smartphones, individuals can browse and purchase products or services from anywhere, anytime.

These are just a few examples of how smartphones and mobile applications have significantly changed the way we live.

Know more about radical changes:

https://brainly.com/question/32952641

#SPJ2

why it is necessary to water the plant for experiment​

Answers

Answer:

To activate the process of germination.

Explanation:

So the plants can get the whole photosynthesis step because it need sunlight and water to continue to grow.

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

Dump out half of the particles. Place your hand tightly over the top and shake the container. Then remove most of the remaining particles, and shake the container again. Compared with the full container, which states of matter do these two models most closely represent? Explain.

Answers

Answer:

solid

Explanation:

The two models explained are most closely representing the "solid" state.

As in both the models the techniques used are to separate particles through shaking technique and shaking is efficient gravity separation method which helps in separating solid particles such as while dealing with tungsten and tin.

Hence, the correct answer is "Solid".

Answer:

When the container was half full, the particles had more freedom to move around than they did when the container was full. A half-full container represents a liquid. When the container had only a few particles, they had lot more freedom to move about. So, this model represented a gas.

Explanation:

plato answer

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Other Questions
Which organelle is the primary site of protein production? A) nucleus B) ribosomes C) cytoplasm C) cell membrane Whats three reasons why sir Edmund Andros was so unpopular in New England After clamping a buret to a ring stand, you notice that the set-up is tippy and unstable. What should you do to stabilize the set-up 1.) Given 30 grams of CO2, how many moles of CO2 would you have? How many individual molecules of CO2 is that?2., Given 22 Grams of NaCl, How many moles of Nacl would you have? How many individual molecules of NaCl is that?3.) Given 50 grams of ammonia NH3, How many moles of NH3 would you have? How many Molecules of NH3 is that? Describe the characteristics of scientific inquiry. why are g protein important for drug discovery? What are some of the moral issues surrounding immigration? A box contains 40 identical discs which are either red or white if probably picking a red disc is 1/4. Calculate the number of;1. White disc.2. red disc that should be added such that the probability of picking a red disc will be 1/4 A piece of solid Fe metal is put into an aqueous solution of Cu(NO3)2. Write the net ionic equation for any single-replacement redox reaction that may be predicted. Assume that the oxidation state of in the resulted solution is 2 . (Use the lowest possible coefficients for the reaction. Use the pull-down boxes to specify states such as (aq) or (s). If a box is not needed, leave it blank. If no reaction occurs, leave all boxes blank and click on Submit.) I need help please help meee I dont understand Two parallel metal plates, each of area A, are separatedby a distance 3d. Both are connected to ground and each plate carries no charge. A third plate carrying charge Qis inserted between the two plates, located a distance dfrom the upper plate. As a result, negative charge is induced on each of the two original plates. a) In terms of Q, find the amount of charge on the upper plate, Q1, and the lower plate, Q2. (Hint: it must be true that Q Empirical evidence from 1960 to 2010 shows that convergence in economic growth is occurring in which of the following cases?a. All low-income countries are catching up to all high-income countries. b. Low-income industrial countries are catching up to high-income developing countries. c. Low-income developing countries are catching up to high-income industrial countries. d. Low-income industrial countries are catching up to high-income industrial countries. Johnstones Realty is a new discount, menu-based brokerage firm. Its approach usually results in a lower listing commission rate than other firms offer. Johnstones also offers a lower cooperating brokerage split than most other firms. Business is booming for Johnstone's, and the remaining firms in town are concerned. These brokers agree to not show Johnstones listings to their buyer clients. What is this an example of? An investigator claims, with 95 percent confidence, that the interval between 10 and 16 miles includes the mean commute distance for all California commuters. To have 95 percent confidence signifies that QUICKLY! The chemical reaction equation of photosyntesis is shown here: What information is not given in this equation. It does not show if the reaction is reversible. It does not show the reactants needed for the reaction. It does not show that photosynthesis consists of many separate steps. It does not show the number of molecules required to produce glucose. Here is a general sequence of events in the development of the Renaissance. Which statement BEST completes the second event? Event 1: Italy's location encouraged trade. Event 2: Event 3: Italy's families became art patrons. A. Italian merchants helped artists and writers study in Muslim lands. B. Italian merchants gained wealth and political power. C. The Renaissance spread beyond Italy to other countries in Europe. D. New Italian city-states emerged to sponsor the Renaissance. A line passes through (-5, -3) and is parallel to -3x - 7y = 10. The equation of the line in slope-intercept form is _____ Hughey Co. as lessee records a capital lease of machinery on January 1, 2011. The seven annual lease payments of $350,000 are made at the end of each year. The present value of the lease payments at 10% is $1,704,000. Hughey uses the effective-interest method of amortization and sum-of-the-years'-digits depreciation (no residual value). Round to the nearest dollar. a) Prepare an amortization table for 2 011 and 2012. b) Prepare all of Hughey's journal entries for 2011. A chemist prepares a solution of sodium chloride by measuring out 25.4 grams of sodium chloride into a 100. mL volumetric flask and filling the flask to the mark with water. Calculate the concentration in mol/L of the chemist's sodium chloride solution. Be sure your answer has the correct number of significant digits. (16 points) Find the radius of convergence and the interval of convergence of the power series. g