What are the 3 main types of star "corpses"? plz hurry

Answers

Answer 1

Answer: white dwarfs, neutron stars, and black holes

Explanation:


Related Questions

Which Punnett square represents a cross between two parents that are heterozygous for purple flowers?
F
f
FF
Ff
f
F
ff
f
f
Submit
Nit

Answers

Answer:

Ff

Explanation:

heterozygous form for purple is Ff

The Punnett square that represents a cross between two parents that are heterozygous for purple flowers are Ff × Ff.

WHAT IS A PUNNET SQUARE?

A punnet square is a square diagram that is used to predict the genotypes of a particular cross between two parents using their gametes.

According to this question, a cross involves two parents that are heterozygous for purple flowers. The genotypes of these parent are Ff × Ff.

Therefore, the Punnett square that represents a cross between two parents that are heterozygous for purple flowers are Ff × Ff.

Learn more about punnet square at: https://brainly.com/question/11660215

Increasing the number of coils in a solenoid or an electromagnet results in a ___
magnetic field.

Answers

Answer: Stronger Magnetic Field

Explanation:

The magnetic field in a solenoid is given by

[tex]B=\mu nI[/tex]

where B=magnetic field

[tex]\mu=[/tex]Permeability

n=no of turns per unit length

I=Current through solenoid

When No of turns increases, it increases the strength of the magnetic field.  

Answer:

Hey I saw that you had the Geometry end of year review escape room I was wondering if you maybe had the answers and work for the rest of the pages?

Explanation:

Thank u

Why do carnivorous
plants sometimes "eat" insects and other organisms?

Answers

Answer:

Because.they are carnivours ya know

Answer:

Like all plants, carnivorous plants are capable of photosynthesis. Since they usually live in areas where the soil quality is poor, they must supplement their diet with nutrients gained from digesting animals. Like other flowering plants, carnivorous plants use tricks to entice insects.

Explanation:

hope this helps have a good rest of your day/night :)

Look at the graph below. A graph is shown with Absolute magnitude shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4. Which of the following stars is most likely to be red? Star A Star B Star C Star D

Answers

Answer:

Star A

Explanation:

If you look directly at the diagram, the dwarf stars are labeled under 'A' and are the least in mass and temperature.

Being the smallest and coldest, dwarf stars most commonly have red coloration, which would make them the obvious choice.

Star A which is a dwarf star has the coldest temperature, and therefore is a red star since red stars are the coldest stars.

What are stars?

Stars are a large self-luminous bodies whichbpriducw large amounts of heat energy and light energy as a result of the nuclear reactions occurring within them.

Stars have different colors and different sizes.

Red stars are the coldest stars and also the least massive.

From the chart, Star A which is a dwarf star has the coldest temperature, and therefore is a red star.

Learn more about red stars at: https://brainly.com/question/11562269

#SPJ2

Help me I’ll give 50 points helppp!

Answers

Answer:

2 Refraction, Transition/bouncing?

7. Opaque, absorbs

Explanation:

StraightLustre,ShineMirrorTransparency, PropertyNot deep,less fastersee,redoblique ,blockswood,more metals,Board,pen

Which describes the number of new infants per one thousand individuals in a
population per year?
A. Birthrate
B. Space availability
C. Carrying capacity
D. Death rate

Answers

Answer: a

Explanation:

birth rate

I think it’s A :) it says birthrate which indicates how many new children are being born.

The more a muscle is stimulated (working), the smaller it will get.
O
true
О
false

Answers

Answer: true

Explanation: Sometimes, a subset of muscle fibers is activated, depending on how much force is needed. When the muscle is stimulated, calcium ions are released from its store inside the sarcoplasmic reticulum, into the sarcoplasm (muscle ). ... The SR is smaller and less elaborate, and stores less calcium ions.

What type of cell is more likely to replicate and replicate faster brain cell or hair cell

Answers

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water

Answers

50% water and 50% vinager

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Answers

Answer:

Reproduction

Explanation:

Answer:

Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.

If you have 2.0 moles of magnesium how many atoms of magnesium do you have?

Answers

Answer:

6.02E+23 atoms

Explanation:

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

Is playstatium a mineral?​

Answers

no, thy substance tis’ no mineral

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Hydrogen ions are found in_____________
which hydroxide ions are found in_______

A. Acids and bases
B. Bases and acids
C. Acids and salts
D. Bases and salts

Answers

Answer:

A

Explanation:

found in acid and bases

correct order of events during the process of nucleosynthesis?

Answers

Answer:

hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed

Explanation:

Answer:

A

Explanation:

took the quiz

what direction was the texas annexation in?

Answers

They faced washington DC

Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation

Answers

Option C i thinkkkkk

2) Jean is a 12 year old girl who consumed chicken that was not fully cooked at a restaurant.
Thirty-six hours later, she started vomiting and was constantly having diarrhea. After a week,
she had a fever and swelling around her eyes and under her neck.


help me pls

Answers

She has salmonella? What is the question?

Salmonella infection and campylobacteriosis cause diarrhea after eating partially cooked chicken. This causes food poisoning.

What is food poisoning?

An illness called food poisoning is brought on by consuming tainted food. Most people recover without treatment in a few days and it's typically not dangerous. The food is typically contaminated with bacteria, such as salmonella or Escherichia coli (E. coli), or a virus, like a norovirus, in cases of food poisoning.

more than three days of diarrhea. A high fever (102°F or above) vomiting so frequently that it is difficult to swallow liquids. Dehydration symptoms include not peeing as frequently, a dry mouth and throat, and feeling lightheaded while standing up.

Hence, Jean suffered from food poisoning caused by salmonella infection.

Learn more about food poisoning, here:

https://brainly.com/question/16327379

#SPJ2

Moving ions against a concentration gradient requires energy and results 2 points
in uneven concentrations of the ions. ATP powers the pump, allowing it to
create and maintain
of these ions. *

concentration gradients
equilibrium
diffusion
osmosis

Answers

Answer:I think osmsis

Explanation:

This animal DOES NOT have live birth, instead this animal...?

Answers

Answer:

The platypus is one of only five species of monotremes in the world. These are mammals that lay eggs instead of giving birth to live young.

:-))

Describe the process of absolute dating as it relates to igneous rock and the fossil record.

Answers

Answer:

Radiometric dating. Geologists use radiometric dating to estimate how long ago rocks formed, and to infer the ages of fossils contained within those rocks. ... When molten rock cools, forming what are called igneous rocks, radioactive atoms are trapped inside. Afterwards, they decay at a predictable rate.

A body cell has been growing and synthesizing proteins. In the nucleus of this body cell, DNA replication is taking place, and a copy of the cell's genetic material is copied. Which of the following is the best conclusion you can make about the life cycle of this cell?

Answers

The best conclusion you can make about the life cycle of this cell is that the cell is in the S phase of interphase and will move next to the G2 phase.

S phase (Synthesis Phase) is the phase of the cell cycle in which all of the chromosomes (DNA) are replicated within the nucleus. During this phase, the DNA is effectively doubled as each chromosome contains two sister chromatids. After the S phase, the cell enters the G2 phase where various proteins (such as microtubules) are synthesized.

Why are volcanoes so important to geologists?

Answers

the location and types of volcanoes are related to plate tectonics as well, so in that sense volcanoes also help us to understand about the tectonic history of a region because if there are volcanoes someplace even if they're not currently active we know that that must have been some sort of a plate uwu

Answer:

you can learn many things from them

Explanation:

scientists are able to examine, that volcanoes remove much of the earth's trapped heat when volcanoes erupt. Volcanoes also make new islands and scientists love to observe their habitats and the animals that inhabit them

What is mass transport across the cell membrane

Answers

Diffusion through a permeable membrane moves a substance from an area of high concentration (extracellular fluid, in this case) down its concentration gradient (into the cytoplasm). The passive forms of transport, diffusion and osmosis, move materials of small molecular weight across membranes.

Does anyone know the answer?

Answers

Answer:

Fungi

Explanation:

students observed several prepared slides of a process that occurs in a dividing onion cell. they observed haploid cells in one slide, centromeres that did not separate during anaphase in another slide, and two different cell divisions resulting in 4 daughter cells in other slides. Which statement is not true about the process that was observed?
1.) the slides were of an egg cell or sperm cell
2.) the process observed produce genetically different cells
3.) the number of chromosomes resulting from the process is reduced by half
4.) the observations suggest cellular reproduction and general growth and repair of the body.

Answers

Answer: pretty sure it could be “B”.

Explanation:

Meiosis produces 4 haploid cells -gametes- from a single diploid cell. The statement that is not true is 4).  the observations suggest cellular reproduction and general growth and repair of the body.

Observed prepared slides:

haploid cells in one slide.centromeres that did not separate during anaphase in another slide.cell divisions resulting in 4 daughter cells in other slides.

According to this information, we can assume that the students are observing the occurrence of meiosis events.

Meiosis

Through Meiosis, a diploid cell (2n) produces four haploid daughter cells (n). Thes haploid cells are the gametes.

After DNA replication there are two meiotic phases.

The first one is a reductive phase, in which homologous chromosomes separate.

In the second phase, the cell suffers a new, not reductive division.

1. In the first phase, Meiosis I:

Prophase I: Chromosomes condensate and become visible. Occurs crossing-over between homologous chromosomes. Crossin-over makes the daughter cells to be genetically different from the original one.

Metaphase I: Homologous chromosomes randomly align in the equatorial plane.

Anaphase I: In this phase occurs the division and independent separation of homologous pairs. Each chromosome migrates to different poles. This separation generates different chromosomal combinations in the daughter cells.

Telophase I: Chromosomes of homologous pairs are already in the corresponding poles, and the nuclear membrane forms again in each pole.

Cytokinesis occurs.

2. In the second phase, Meiosis II:

Prophase II: Chromosomes condensate again and become visible.

Metaphase II: Chromosomes join the spindle apparatus and migrate to the equatorial plane, where they randomly line up. Sister chromatids are holden together until they reach the Anaphase.

Anaphase II: Centromeres divide, chromatids get separated, and each of them goes forward an opposite cellular pole.

Telophase II: Once in the poles, the chromosomes become lax again, and the nuclear membrane forms again.

Cytokinesis occurs.

Options

1.) the slides were of an egg cell or sperm cell ⇒ Correct. It makes reference to gametes -haploid cells-.

2.) the process observed produce genetically different cells ⇒ Correct. After crossing over and independent segregation of chromosomes.

3.) the number of chromosomes resulting from the process is reduced by half ⇒ Correct. After the reductive phase.

4.) the observations suggest cellular reproduction and general growth and repair of the body. ⇒ INCORRECT. Mitosis is in charge of general growth and repair of the body, not meiosis.

You will learn more about meiosis at

https://brainly.com/question/7002092

Can someone explain the Punnett square ?

Answers

Answer:

so in the punnet square, you hvae the 4 squares inside the big on. on top of the square, you have 2 letters, representing the dominant and the repressed genes. On one side, typically  the left, you have another two letters, again genes. to get the gene types to fill in your squares, you take the first letter of the top set and the first letter of the side set. for this example, we are going to use Bb(top) and BB(side). you would take the B from the top, and you would pu it with the B from the side. in the top left square, you should have BB. next, you go and take that same top B and do it with the second letter of the side, B again. this again gives you BB.  next, you take the second letter of the top, b, and you join it with B. in the top right square, you would write or type in Bb. Even though the b was on top, it is after the B because in this cause, it is not the dominant gene. when you do the second top and side letters together, you again get Bb.

Explanation:

the main points.

in this example, i used B to be the dominant gene and b to be the repressed/ submissive gene. you always put the dominant gene letter before the repressedmake sure you fill the squares in properly. in this one, you should have 3 BB and 1 Bb. this shows that the gene set BB is going to showwhen you fill in the squares, the first top letter and the first side letter fill in the top left square.the first top letter and the second side letter go left bottom.second top letter and first side letter go in right top.second top and second side go in right bottom.always place the dominant gene first in the punnet square.

add me and message me if you need more help. we can also zoom to figure it out.

The Punnett square is a square diagram that is used to predict the genotypes of a particular cross or breeding experiment. It is named after Reginald C. Punnett, who devised the approach. The diagram is used by biologists to determine the probability of an offspring having a particular genotype.

what is not a main principle of the cell theory?

a-cells are the basic unit of structure and function in living things

b-new cells are produced from existing cells

c-all cells enclose their DNA within a nucleus

d-all living things are made of cells

Answers

Answer: c not all cells have a nucleus (prokaryotic cells don’t)

Explanation:


Which best explains the role of plants in the nitrogen cycle?

Answers

Answer:

Assimilation

Explanation:

This is how plants get nitrogen. They absorb nitrates from the soil into their roots. Then the nitrogen gets used in amino acids, nucleic acids, and chlorophyll. ... When a plant or animal dies, decomposers like fungi and bacteria turn the nitrogen back into ammonium so it can reenter the nitrogen cycle.

Plants absorb nitrogen compounds out of soil and animals can get it.
Other Questions
NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership.