what are cotyledons? & what is its use

Answers

Answer 1

Answer:

Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.

*You Can put this in your own words


Related Questions

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer

Answers

Answer:

C Respond to the environment

A mouse running away from the sound of an owl's wings is responding to the environment.

What are living organisms?

The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.

Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.

The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.

Therefore,  A mouse running away from the sound of an owl's wings is responding to the environment.

To learn more about sensitivity refer to the link:

https://brainly.com/question/14057226

#SPJ2

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.
Other Questions
Will yall help me please help me i will help yall whenever yall need points just ask something or i will make things where i will get yall some points just will help me on this quiestion..? log(x+4)=logX + log4 Which of the following groups of people would support democracy for all and drastic changes within the government?1 conservative?2 Liberals3 radicals 4 parliamentarians Which of the following lists of fractions are in order from least to greatest? Select TWO that apply.A.1/4 2/3 3/10B.3/5 7/10 5/6C.2/5 5/8 3/4D.3/8 9/10 7/12HELP Edge notesI took notes on the climate section so hope it helps Can you please help me 7. Which of the following is a proof that light travels in a straight line?A. Formation of cloudsC. Formation of rainbowsB. Formation of colorsD. Formation of shadow The diameter of a cake is 7.8 inches. What is the area of the cake? Carl bought a stock for $56. He sold it a week later after its value had dropped below $30. How would you describe the size of Carl's loss An investor has an account with stock from two different companies. Last year, his stock in Company A was worth $5660 and his stock in Company B was worth $2500. The stock in Company A has increased 5% since last year and the stock in Company B has increased 9%. What was the total percentage increase in the investor's stock account? Round your answer to the nearest tenth (if necessary). For a reaction to be in equilibrium.... *A. concentration of reactants and products remain constantB. concentration of reactants and products must be the sameC. the rate of forward reaction is not equal to the rate of backward reaction. Which one of the following U.S. customary units is closest in volume to I liter? Can someone please help me with this question Please check this answer Please tell me if its correct if its not please answer it correctly please ummmm, what?????? could i get some nice help How does social media influence our mental and emotional health? Based on the information in the graph, what is the best conclusion to drawabout Africa?World Population Growth20,00010,000TMWorldOMON5,000*Asia2,000WORKAfricaNA1,000Europe*****500200United States,Canada, and Greenland 100 POINTS!!!In at least one hundred words, give an overview of the basic tenets of the Igbo belief system, as described in Achebes Things Fall Apart. Use evidence to support your answer. Fast Auto Service provides oil and lube service for cars. It is known that the mean time taken for oil and lube service at this garage is 15 minutes per car and the standard deviation is 2.4 minutes. The management wants to promote the business by guaranteeing a maximum waiting time for its customers. If a customer's car is not serviced within that period, the customer will receive a 50% discount on the charges. The company wants to limit this discount to at most 8% of the customers. What should the maximum guaranteed waiting time be what is the vertex of the graph?A. (2,2)B. (1,3)C. (3,1)D. (0,2) One negative effect that tourism has had in the Caribbean is that itA. takes jobs from local workersB. leads to water shortagesC. has destroyed the sugar-based economyD. has led to greater government control over the economy