Water makes up a large percentage of the body's cells. For a cell to remain in homeostasis, there must be a
mechanism to control water changes in the cells. The movement of water from an area of high water concentration
an area of low water concentration is
a. diffusion
b. osomosis
c. active transport
d. stable transport
so which one really is it....

Answers

Answer 1

Answer:

B. Osmosis

Explanation:

Answer 2
Osmosis
Hope this helps

Related Questions

Which plant cell structures capture sunlight to produce sugars? a. vacuoles b. ribosomes c. mitochondria d. chloroplasts​

Answers

Your answer is D. It uses light energy of the sun into sugars that can be used by cells. It is like a solar panel that changes sunlight energy into electrical energy.

You want to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%). How much of each will he have to mix together? Show your work for full credit.

Answers

Answer:

To make a 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%), 0.6 tons of soybean meal and 0.4 tons of corn are needed

Explanation:

Using the Pearson’s Square calculations:

1. Subtract across the diagonal:

a. 18% - 12% = 6 parts soybean meal

b. 18% - 22% = 4 parts corn

2. Sum the parts:

a. 6 parts soybean meal + 4 parts corn = 10 totalparts

3. Divide each part by the total to calculate the percentage of each feed to include in the ration:

a. 6 parts soybean meal ÷ 10 total parts * 100 = 60.0% soybean meal

b. 4 parts corn ÷ 10 total parts * 100 = 40.0% corn

So, to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%),

60% of soybean meal is needed = 60/100 * 1 ton = 0.6 tons of soybean meal

40% of corn is needed = 40/100 * 1 ton = 0.4 tons of corn

The purpose of the control is to ..?

Answers

The control group is used as the constant variable

True or False.
The lymphatic and immune systems contain the lymphatic vessels and ducts, lymph nodes, bone marrow, and spleen.

Answers

Answer:

True

Explanation:

I also like your profile picture

The lymphatic system consists of  lymphatic vessels and ducts, lymph nodes, and spleen. The immune systems consist of bone marrow. Hence, statement true.

What is immune system?

The system that helps to fight infections and diseases with the help complex system of tissues, cells, organs is called as immune system.

In humans, immunity is of 3 types including:

adaptive immunity- natural immunityinnate immunity- develops throughout lifepassive immunity- borrowed from any source that doesn't last long.

Bone marrow and the thymus are primary parts of the immune system. Bone marrow play significant role in production of blood cells including B and T lymphocytes. In also includes organs of lymph system such as lymph node, thymus, spleen, tonsils, lymph node, and lymph vessels.

Therefore, The statement above is true.  

Learn more about immune system, here:

https://brainly.com/question/19843453

#SPJ3

What kind of inheritance is horse color an example of?

A. Complete dominance
B. Incomplete dominance
C. Co-dominance

Answers

i think the answer would be a , because of the certain color is more popular than an another based on the the gene but i can be completely wrong , correct me if i am :)

Which component of a galaxy consists of tiny particles that look smoky or cloudy and can be found in the space between stars? A) Gas B) Stars C) Dust D)Sun

Answers

Answer: Gas

Explanation:

Look through the lesson lol i know your school

Nebulae are different luminous regions of the interstellar medium that can be made up of cosmic dust as well as ionized, neutral, or molecular hydrogen, hence option C is correct.

What is dust?

All the stuff between stars is referred to as interstellar matter by astronomers, and the complete collection of interstellar matter is referred to as the interstellar medium (ISM). Some interstellar material is gathered into massive clouds that are each referred to as a nebula.

Tiny pieces of solid matter drifting about in the region between stars make up cosmic dust. It's not like the dust you find in your home; instead, it has tiny particles that range in size from collections of just a few molecules to grains that are 0.1 mm in size.

Therefore, an interstellar medium can be made up of cosmic dust as well as ionized, neutral, or molecular hydrogen, hence option C is correct.

Learn more about the dust, here:

https://brainly.com/question/562915

#SPJ6

23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA

Answers

Answer:

D

explanation: it literally has physics in its name

A cactus with the genotype Kkww is crossed with a cactus with the genotype KKWw. Which of the following genotypes will be shared by 25% of the offspring?
A. KKWW
B. kkWw
C. KKww
D. KkWW

Answers

Answer: C

Explanation: Think of it this way, which ever has the most is what answer would be. So they come across 3 capitals with K its gonna be KK not kk.

Hope this helps

The genotype is defined as the genetic makeup of an organism, or the set of alleles. The cross between Kkww and KKWw will result in 25% of the progeny having genotype KKww.

The correct option is:

Option C. KKww

Find the attachment for the Punnett square, given below.

The cross between Kkww and KKWw will result in the gametes as:

Kkww - Kw, Kw, kw, kwKKWw - KW, Kw, Kw, kw

The progeny having genotype as KKww will be 4 or 25%.

Therefore, Option C is correct.

To know more about cross and Punnett square, refer to the following link:

https://brainly.com/question/14642557

The phylogenetic tree shows characteristics used in classifying land vertebrates.
frog
iguana
amnion
duck-billed
platypus
kangaroo
hair,
mammary
glands
gestation
long gestation
beaver
Which statement correctly represents the characteristics shared by the vertebrates?
The frog and the iguana both have amnion.
The frog and the beaver both have gestation and amnion.
The kangaroo and the beaver both have hair, mammary glands, and long gestation
The duck-billed platypus and the kangaroo both have amnion, hair, and mammary glands.

Answers

Answer:

The kangaroo and the beaver both have hair, mammary glands, and long gestation.

Explanation:

Because I had the same question on a test and I failed and see that this was the answer

What absorbs water in the digestive system

Answers

Your answer is Small Intestine.

Your small intestine makes digestive juice, which mixes with bile and pancreatic juice to complete the breakdown of proteins, carbohydrates, and fats. Bacteria in your small intestine make some of the enzymes you need to digest carbohydrates. Your small intestine moves water from your bloodstream into your GI tract to help break down food. Your small intestine also absorbs water with other nutrients.

Answer: Small intestine

Either you put small intestine in the wrong place, or you're able to put the same one for multiple questions

2x+3y=12
x-5y=-7
solve simultaneously ​

Answers

Hey this answer your question

Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.


dissolved oxygen in water

treated waste water

viruses

combined sewage overflow (CSO)

fertilizers

cleaning products

dog poop on the streets of NYC

water running over rocks


(This is 7th grade science)

Answers

I’m not sure about the rest but I think Dog poop is one

The photo shows a student using email.
What is the main need or want this wave technology meets?
A. To hear and see others in real time
B. To efficiently communicate with others
c. To speak with and see others who are far away
O D. To efficiently store and share music with others

Answers

Answer:

B. To efficiently communicate with others

Explanation:

picture

Answer:

B

Explanation:

Unzips the DNA strand by breaking hydrogen bonds

Answers

HELICASES unzips the dna at the beggening of replication to then break the hydrogen bonds

During which phase of mitosis do the chromosomes pull away from the middle of the cell?

Answers

In Anaphase of mitosis chromosomes pull away from the middle of the cell.

During this period the replicated chromosomes are split and moved to the opposite poles of the cells.

What is mitosis?

It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.

What are chromosomes?

It is along DNA molecule with part or all of the genetic material of an organisms.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ2


1. How is natural selection related to the process of evolution?

Answers

Answer:

Natural selection is related to the process of evolution because It is one of the processes that drives change and helps to clarify the diversity of life on Earth.

Explanation:

Hope that helps

which of the following is a density dependent limiting factor?

Answers

There is no picture???

HELP PLEASE

At Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event?

A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites.
B. It provided money to businesses responsible for toxic waste sites to clean up their pollution
C. It helped boost the economy among those waste sites
D. It helped identify toxic waste site and move people away from them​

Answers

Answer:I’m stuck on the same question

Explanation:

Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle

Answers

Answer:

the nitrogen cycle, the water cycle, and the carbon cycle

Explanation:

The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.

The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.

What is a biogeochemical cycle?

The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.

These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.

Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.

Learn more about biogeochemical cycles here:

https://brainly.com/question/1204069

#SPJ2

What molecule do organisms obtain energy from

DNA
ADP
Sugar
ATP
All the above.

Answers

Organisms mainly use the molecules glucose and ATP for energy. Glucose is a compact, stable form of energy that is carried in the blood and taken up by cells. ATP contains less energy and is used to power cell processes. The flow of energy through living things begins with photosynthesis, which creates glucose.
Answer:
ATP

Explanation: as the other person said they mainly use glucose or ATP for energy. Adenosine triphosphate (ATP) is the source of energy for use and storage at the cellular level. The structure of ATP is a nucleoside triphosphate, consisting of a nitrogenous base (adenine), a ribose sugar, and three serially bonded phosphate groups.

I hope this helped !

7th Grade Science Yes i will brain list
What is a convection current?

Answers

a current in a fluid that results from convection.

What are the advantages and disadvantages to produce few offspring that are extensively cared for and protected?

Answers

Advantages: Since they’re well cared for, they will grow up to be strong and hopefully produce healthy offspring.
Disadvantages: Fewer of them means that when one is lost, it will have a greater effect on the group. They also cannot reproduce as quickly as if they had lots of offspring.

What portions of RNA are cut out and discarded during the process of RNA editing

Answers

Answer:

 introns are portions of RNA that are cut out and discarded.

Explanation:

1. Why is it important to have some access to water?

2. What physical and social factors can contribute to making water unte?

3. Why is it not safe to drink the water in the Attowopikat First Nation community

4. What would be sustainable solution to the problem of unsafe drinking water in Attawapiskat?

Answers

Answer:

1.Water is obviously essential for hydration and for food production—but sanitation is an equally important, and complementary, use of water.

2.Sedimentation.

Runoff.

Erosion.

Dissolved oxygen.

3.Ontario First Nation of Attawapiskat isn't safe. It has high levels of a chemical byproduct produced by the chlorination process in the community's ailing water plant that needs millions of dollars in repairs.

4.Boiling. This is a reliable way to purify water.

Use of Iodine solution, tablets or crystals. This is an effective and more convenient method. ...

Use chlorine drops. Chlorine has the ability to kill bacteria in water. ...

Use water filter. ...

Use Ultraviolet Light.

Is a chicken egg biotic (living) or abiotic (non-living)? *
biotic (living)
abiotic (non-living)

Answers

Answer:

its biotic

Explanation:

Chicken egg is biotic.

What are biotic or abiotic components?

Biotic components are living organisms while abiotic components are nonliving organisms. All biotic components are living components of ecosystem. Bacteria and birds, animals  are living components.

Abiotic components are non living components. sunlight, water and temperature are the non living components. Biotic factors are producers, herbivores and omnivores.

Abiotic components are physical and chemical components that act on the living components. In chicken cell the yolk which is living cells.

Biotic components also include the waste from living things and dead organisms. Earth have many biotic components. The surface of Mars has no biotic components.

Therefore, Chicken egg is biotic.

To learn more about biotic components, refer to the link:

https://brainly.com/question/18686232

#SPJ2

please help meeeeeeeeeee

Answers

Answer:

D

Explanation:

D like the person above

2. Which of the following is a physical property of matter that is always the same regardless of size
or amount?

A. Mass
B. Volume
C. Density
D. Solubility

HELP

Answers

i think it’s D lol, it’s not mass because like duh and not volume and density like no?? so c because it’s always going to dissolve the same

Answer:

A

Explanation:

Since the law of conservation of mass is valid under all circumstances, hence, mass always remains the same, whether a substance undergoes physical change or chemical change

⚠️Second time posting this⚠️
Geneticists use Punnett Squares to show all the possible outcomes of a genetic cross and to determine the probability of a particular outcome.
True
or
false

Answers

Answer:

True

Explanation:

Scientists only use punnet squares if they want to determine what the possible outcomes will be for the offspring.

Hope this helps, if it is wrong, I am sorry. T^T

Answer:

   true

Explanation:

Identify the labeled structures.
A: B: C: D: E:
The multiple questions are the same for each question. Please help!

Answers

Answer:

e cell wall that is the only one I am sure of because I can hardly see the rest

If the process of meiosis shown to the right proceeds
normally, how many
chromosomes will cells A, B, C, and D have?
B

Answers

Answer:

If I’m correct it’s 15

Explanation:

Other Questions
If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document A dental hygienist is a health-care professional who works alongside a dentist to meet the oral health care needs of patients. Asked by one of her clients who needs to get a cavity filled what the average number of cavities a person gets filled by the time they are 50 years old, the hygienist responds that she will gather and determine not just the average, but also the median and the mode - because she would like to know this information herself. A bit of research turns up the following data table taken from a research project of a graduate student. The graduate student surveyed 20 people aged 50 from around Idaho.Patient ID# Cavities Filled1 12 83 74 95 116 127 78 59 210 011 812 913 714 615 816 917 818 919 820 8a. What is the mean (average) number of cavities a person gets filled by age 50?b. What is the median number of cavities a person gets filled by age 50?c. What is the most often an occurring number of cavities filled in this data set? Solve for n.(33)^2 = n^6 A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 i need help!!!!!!!!! Which expression is equivalent to 8(5-2a)? 3 Write an expressionto represent:"Twice a number 51increased by 51"