Use two words to describe each rock type.

Answers

Answer 1

Igneous: Crystal rock

Metamorphic rock: Changing rock

Sedimentary: Sediment deposited

Does this work? lol

Have a blessed day!! :))

Answer 2
rock in the ground that sitting in the ground

Related Questions

Which is NOT an example of a structural adaption?
A. a pelican's pouch-like beak
B. Camouflaged seahorses
C. The migration of birds
D. dense fur on a brown bear

Answers

Answer:

D

Explanation:

Your sooo wellcome Honey

D) dense fur on a brown bar

The main difference between ocean water and lake water is that ocean water contains - *

A. oxygen
B. salt
C. sediment
D. plants

Answers

Im pretty sure its salt ;-;
B salt cause ocean water is salt and lake water is fresh

HELP URGENT!! My bunny just had babies they are not moving what should I do??????

Answers

CHECK IF THWY ARE BREATHING
the little rabbits are visibly injured (bleeding or nonfunctioning limbs, for example) or obviously suffering, it's best not to touch or move them

You are looking out over the ocean and see this:

What can you know about the tide?

Answers

When we are looking out over the ocean and see this: We can know about the tide that it must be neap tides. Thus, the correct option is A.

What are neap tides?

A neap tide occurs seven days after a spring tide. It refers to a period of moderate tides when the sun and the moon are at right angles to each other in space. A spring tide is a common historical term which has nothing to do with that of the season of spring.

A tide just after the first or third quarters of the Moon when there is least difference between the high and low tides is called as Neap tide. During this time, the Moon and the Sun are at right angles to that of the earth. As a result of this, the high tides are not too high, and the low tides are not too low.

Therefore, the correct option is A.

Learn more about Neap tides here:

https://brainly.com/question/29417771

#SPJ5

A scientist observes two stars in the night sky through a telescope. Star A is white in color and relatively dim. The star’s estimated temperature is very high.

Star B is red in color and extremely bright. The star’s temperature is low compared with other stars.

Help the scientist classify the two stars.

Answers

Answer:

Star A is a Neutron Star while Star B is a Red Giant

Explanation: Neutron star is a very hot star, very small in size and hence dim and is white in color. A neutron star results after a massive star goes supernova. It is primarily composed of neutrons packed in a small boundary.

 star B would be a red giant. This is because, a red giant star is red in color, is very big in size, and has a low temperature. A red giant star is a towards the end stage of a small to an average mass star.

I think

Star A is an white dwarf star

a travel agency wants people to go on a tour of a mountain region with many glaciers. write a paragraph for a travel brochure describing what people will see on the tour. in your answer, include features formed by glacial erosion and deposition
God bless, stay safe, and happy holidays! :)

Answers

Answer:

Cheap paper writing service provides high-quality essays for affordable prices. It might seem impossible to you that all custom-written essays, research papers, speeches, book reviews, and other custom task completed by our writers are both of high quality and cheap.

Explanation: hope that helps

Study the table about Earth’s interior.

A 4 column table with 5 rows. First column is unlabeled with entries: Crust, uppercase mantle, Lower mantle, Outer core, Inner core. Second column is labeled Thickness in kilometers with entries: 30, 720, 2,171, 2,259, 1,221. Third column is labeled Density in grams per centimeters cubed, divided into Top and Bottom columns. Top entries are: 2.2, 3.4, 4.4, 9.9, 12.8. Bottom entries are 2.9, 4.4, 5.6, 12.2, 13.1. Fourth column is labeled Types of Rock Found with entries: Silicic rocks, Peridotite, Magnesium and silicon oxides, Iron plus oxygen, Iron plus oxygen.

Which conclusion is supported by information in the table?

The mantle is thinner than the crust.
The core is the thickest of Earth’s layers.
The inner core is thicker than the outer core.
The mantle is the thinnest of Earth’s layers.

Answers

Answer:

a) No

b) Yes

c) No

d) No

I hope this helps you

Answer:

B

Explanation:

Can someone plz answer the two questions below plz and thank you!!!

Answers

Answer:

What questions

Explanation:

It isn’t any questions here?

The bending of plants toward the light sources serves which purpose in terms of plant’s metabolism?

Answers

Answer:

B

Explanation:

TOOMK THE  Q8IX

The correct answer is B

The temperature of the water in Glass A is 90°C. The temperature of the water in Glass B is 30°C. When each is poured into a container of water which is 60°C, which of the following statements is most likely to occur?

A. Water from Glass A will sink to the bottom while water from Glass B will sink.
B. Water from Glass A will rise to the top while water from Glass B will sink.
C. Water from Glass A will sink to the bottom while water from Glass B will rise.
D. Water from Glass B will rise to the top while water from Glass A will rise.

Answers

b because heat rises

please help
Which sentence supports the fact that we always see the same side of the Moon?
The Moon takes about four weeks to rotate once on its axis and about the same time to orbit the Earth. The gravitational effect of Earth has slowed the rotational period of the Moon to match its orbit. Since the rotational period is exactly the same as the orbital period, the same portion of the Moon always faces Earth. As the Moon orbits Earth, the lit side that we see changes in size. These changes are called the lunar phases.

Answers

Answer:

Sentence 3

Explanation:

Sentence 3 states exactly what the question wanted for an answer, "Since the rotational period is exactly the same as the orbital period, the same portion of the Moon always faces Earth."

Answer: sentence 3

Explanation:

Ocean water is-
A. mixture
B. compound
C. element
D. fresh water

Answers

Ocean water is fresh water :))

7th grade science need help

Answers

Answer:

The answer is B

Explanation:

the answer i believe is probably B

is albinism a dominant or recessive trait? Explain your answer.

Answers

Answer:

albinism is a recessive trait.

Explanation:

In order to have the genetic mutation, you must have two of the gene for it to be present. However, if you only have one of the genes, you are a carrier for said mutation.

hope this helped :)

Fill in the Blank:

Word Bank:
Decreases, Increases, Daughter, Replicates, Surface Area, Translates

As a body cell grows, the ratio of _______ to volume _________. Before it grows to large, a cell will divide into two ________ cells. So that each new cell receives its own genetic instructions, the cell ________ or copies, all of its DNA.

Answers

Answer: As a body cell grows, the ratio of SURFACE AREA to volume INCREASES. Before it grows to large, a cell will divide into two DAUGHTER cells. So that each new cell receives its own genetic instructions, the cell REPLICATES or copies, all of its DNA.

Explanation:

As a body cell grows, the ratio of surface area to volume decreases. Before it grows to large, a cell will divide into two daughter cells. So that each new cell receives its own genetic instructions, the cell replicates or copies, all of its DNA.

The volume of a growing cell increases at a larger pace than the surface area. Hence the ratio of the surface area to the volume of the cell keeps decreasing. At a certain point, the signal to divide is given and this leads to the division of the cell into two daughter cells.

Just before the division, the genetic material of the cell is replicated and other important biomolecules are synthesized before the final call can be made.

More on the cell cycle can be found here: https://brainly.com/question/25282664?referrer=searchResults

Researchers have been studying how emissions from both volcanoes and human activities, such as the burning of fossil fuels, impact the atmosphere. Both types of emissions contribute to the total CO2 levels in the atmosphere. Graph 2 shows that atmospheric CO2 levels have been steadily increasing over time. This increase in CO2 levels has been linked to the increase in global surface temperatures.

Explain why the total mass of carbon must be decreasing in a different step of the slow carbon cycle based on the on the increase in atmospheric CO2.

Answers

Answer:

just look at the graph it literally tells you the answer

Focus your answer on what causes a genetic disorder (be specific) and what happens from there. Use the terms below in your answer.

protein nucleus chromosome ribosome gene hemoglobin

Answers

Answer:

It is caused by mutations

HELP ME PLZ- I HATE SKOOL >:((

Answers

l hate school toooooooo:(
Beach mice:
Since the beach mice live in the beach (obviously) that is their ecosystem. This means that there are predators that eat the mice on the beach.

Let us assume that the mice in the beach have been isolated from the other deer mice and therefore could not reproduce with them

It comes down to survival of the fittest. The mice with the lightest fur survived because they blended in with their environment and avoided predators, so they reproduced and created more “light coat” offspring. Each generation the mice with the light coats were able to escape predation and reproduce. Therefore it is reasonable that the two mice have different genes that code for their fur colour.

The forest mice need a darker fur to blend in with their environment to avoid predation, so they’re fur stayed darker over the generations for the same reasons listed above ( vice versa of course )

HURRY I WILL GIVE BRAINLEST JUST PLS HURRY IM ON MY FINALS EXAM!!!!!!

Which scientist most inspired Darwin to pursue his studies of evolution?

A. Linnaeus, who first proposed that humans and primates are similar
B. Malthus, who thought that populations could outgrow their food sources
C. Linnaeus, who thought that populations could outgrow their food sources
D. Malthus, who first proposed that humans and primates are similar

Answers

Answer:

B. Malthus, who thought that populations could outgrow their food sources

Explanation:

Thomas Malthussssssss

Pleace and peace!!!!!!!!!!!!!!!!!

Answers

Answer:

Part a: C)

Part b: A)

Explanation:

a heterozygous (Rr) and a Homogenous (rr)

Part a: C)

There is only one out of 4 (Rr) so 1/4

A)

Answer:

C for part a

a for part b i think

Explanation:

What are some important functions cells perform in the human body?

Answers

Answer:

1: Movement (muscle cells) 2: Conductivity (nerve cells) 3: Metabolic absorption (kidney and intestinal cells) 4: Secretion (mucous gland cells) 5: Excretion (all cells) 6: Respiration (all cells) 7: Reproduction (all cells) MedicTests.com.

Explanation:

Please Help!!!! Thank You! 15 points!

Answers

Okay what am I answering for you

Answer:

okay what is the question

Which of these factors is involved in earthquake formation?

Answers

Answer:

Earthquakes are usually caused when rock underground suddenly breaks along a fault. This sudden release of energy causes the seismic waves that make the ground shake. When two blocks of rock or two plates are rubbing against each other, they stick a little. They don't just slide smoothly; the rocks catch on each other.

Explanation:

a earthquake is formed when, two titanic plates rub together and then get caught on each other which creates a earthquake

PLEASE HELP, WILL GIVE POINTS AND BRAINLY!!!!
The pictures show the Arctic ice cap in 1979 and 2003.
Do the pictures provide evidence for global warming? Explain.

Answers

Answer:

Yes because it show how the ice caps have gottin smaller due to global warming

Explanation:

Answer:

Changes in the amount of sea ice can disrupt normal ocean circulation, thereby leading to changes in global climate. Even a small increase in temperature can lead to greater warming over time, making the polar regions the most sensitive areas to climate change on Earth

Explanation:

Changes in the amount of sea ice can disrupt normal ocean circulation, thereby leading to changes in global climate. Even a small increase in temperature can lead to greater warming over time, making the polar regions the most sensitive areas to climate change on Earth

1979

Explanation:

Do you think that humans and humpback whales share a common evolutionary lineage?

Answers

Answer:

Yes!

Explanation:

Yes because when it comes to whales and humans we have a lot in common. They have different behaviors and languages within their own culture as humans do.They come in a lot of sizes and have different behaviors. Just like us and they are also mammals. While other sea creatures have gills.

Answer:

Scientists have used computer analysis to read evolution backward and reconstruct a large part of the genome of an 80-million-year-old mammal. This tiny shrewlike creature was the common ancestor of humans and other living mammals as diverse as horses, bats, tigers and whales.

Explanation:

In the image below, which objects would have a greater gravitational force between them, Objects A and B, or Objects B and C? Give one supporting detail for your answer.

Answers

B and c

Its because heavier objects have a higher gravitational force

Answer:

Objects A and B

Explanation:

The Bigger the Object the more gravitational force, there is other thing that effect gravitational force but in this one it is size.

help please fill in the blank
The mass of an object is 45 kilograms. Its weight on Earth is(blank)newtons, and its weight on the Moon is (blank) newtons

Gravitational force is 9.8 m/s2 on Earth and 1.6 m/s2 on the Moon.

Answers

Answer:

441N and 72N

Explanation:

W=mg

W=45×9.8=441N

Its weight on earth is 441N

W=mg

W=45×1.6=72N

Its weight on the moon is 72N

Answer:

441 Newtons and 72 newtons

Explanation:

Why? Answer down below!

Heey may someone plz help me with these two questions thx!!!

Answers

Answer:

4 is d and 5 is a

Explanation:

PLEASE HELP 20 POINTS
Describe some of the main geologic events occurring during the Mesozoic era. This would include formation of mountains, opening of oceans, crunching continents, volcanic activity, major deposition of sediments, major structures eroded, etc:

Answers

Answer:

When the meteor hit a caused a chain reaction which caused all that and made some cloud that was toxic.

Explanation:

What is the molecule that is responsible? for albinism and colorblindness

Answers

The answer is melanin.

Mark me brainliest!

Answer:

melanin i believe

Explanation:

Other Questions
Fill in the blank with the Spanish word that best completes the following sentence.Cuando necesito dinero, hablo con _________. 5) In a urea manufacturing plan, all employees work a basic week of 40 hours. Ay overtime worked during weekdays is paid for at time-and-a-quarter. Overtime worked on Saturday is paid for at time-and-a-half, whilst on Sunday it is paid for at double time. If the basic rate is $14.60 per hour and a man worked 15 hours overtime during weekdays, 6 hours overtime PLEASE HELP ME!! I WILL MARK BRAINLIEST!! : How did the events in the reading establish Portugal as a major trading centre? What were some of the goods that the Portuguese traded? Were these different from those that the Italian merchants offered? What is inflation A. An increase in the supply of currency that reduces the currencys value B. A demand for more goods that can be met by production C. An increase in unemployment due to a serious recession D.an excess of goods that results in lower prices Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast. help child.......help me need help thank you very