True or false based on the context in paragraph 3 a thin soft pliable sheet or layer

Answers

Answer 1

Answer:

Explanation:no para3 here


Related Questions

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

what is a sedimentary rock

Answers

Answer:

Sedimentary rocks are formed from pre-existing rocks or pieces of once-living organisms. They form from deposits that accumulate on the Earth's surface. Sedimentary rocks often have distinctive layering or bedding. Sedimentary rocks are types of rock that are formed by the accumulation or deposition of mineral or organic particles at the Earth's surface, followed by cementation. Sedimentation is the collective name for processes that cause these particles to settle in place. Sedimentary rocks are made when sand, mud and pebbles get laid down in layers. Over time, these layers are squashed under more and more layers. Eventually, the layers are lithified – turned to rock. Sedimentary rocks can be formed in deserts, lakes, rivers and seas .

Inherited used in a sentence

Answers

I inherited my parents genes.

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

please HELP me i cant fail this class What are the two forces of gravity that contribute to tectonic plate movement at mid-ocean ridges?

Ridge subduction and slab flight


Ridge slip and slab slide


Ridge push and slab pull


Gravity does not pull them

Answers

Answer:

"Plate movement is thought to be driven by a combination of the motion of the seafloor away from the spreading ridge (due to variations in topography and density of the crust, which result in differences in gravitational forces) and drag, with downward suction, at the subduction zones."

Explanation:

Does this help?

It is because of ridge slip and slab slide i the divergent plate boundaries, where tectonic plates movement creates mid ocean ridges.

What is divergent boundary?

Divergent plate boundaries are the regions where the tectonic plates are diverging from one another, this is known as a divergent plate boundary. Above upward convection currents, this happens.

The lithosphere's base is pushed upward by the rising current, which lifts it off the ground and flows lateral currents beneath it. When an oceanic lithosphere border diverges, the rising convection current beneath raises the lithosphere, creating a mid-ocean ridge.

The plate material above is dragged along in the flow direction by this lateral flow. The overlaying plate is thinned out, fractures, and pulls apart at the peak of the uplift.

Hence, in fact it is not by the gravitational pull but by the ridge slip.

To find more on plate movement, refer here:

https://brainly.com/question/3970445

#SPJ6

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which is required for sexual reproduction

Answers

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.

Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?

Answers

Answer:

3.5264 x [tex]10^{7}[/tex]

Explanation:

The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.

In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.

So the short ton produced will be

= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102

= 3.5264 x [tex]10^{7}[/tex] short ton.

Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes

Answers

C definitely c hope this helps

The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.

What do you mean by Genotypes?

Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.

In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.

Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).

To learn more about Gene interaction, refer to the link:

https://brainly.com/question/25217589

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ

Answers

Answer:

01). cells

02).seeing inside the cells

03).Robert hook

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Is sand called sand because its in between the sea and the land?
I'm asking the questions that need to be asked people! :'D

Answers

No, not at all. ... The English word 'sand' comes from Old Dutch/proto-German 'zand', which has nothing to do with either sea OR land, but referred originally to unstable ground, as near rivers.

I hate the English language sometimes, like: "waterfall". But anyways, I hope this helps ^^

Hmmm... I've never thought of that before... nice catch lol

Have a great day :D

A student placed a small chip of limestone into a hydrochloric acid solution, and carbon dioxide gas was released. The carbon dioxide provided evidence that
A. The formation of an element occurred.
B. Only a physical change occurred.
C. A chemical change occurred.
D. Only a loss of mass occurred.

Answers

C. A chemical change occurred.

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

How does the force of gravity move objects in the solar system?

Answers

Answer:

One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

How many factors should a well-designed experiment test at one time?

Answers

Answer:

Depends on the number of experiment variables.

Explanation:

You should only test one variable/factor

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

Why is biodiversity important for ecosystems?

Answers

Answer:to stop from extinction

Explanation:

I need help with this (last question I had had the picture all black)

Answers

Answer:

I only know A

I think it's the lap

Describe and explain how the two types of white blood cells fight pathogens? 6 mark

Answers

Answer:

White Blood Cells Defend the Body Against Disease

Neutrophils are phagocytes, cells that consume invading pathogens. Lymphocytes, the second most common type of white blood cell, disseminate through the organs and tissues of the lymphatic system. Lymphocytes target specific pathogens as part of the immune response.  

Explanation:

Which of the following solutions is neutral?


Group of answer choices


a solution with a pH of 14


a solution with a pH of 2


a solution with a pH of 7


a solution with a pH of 9


Flag this Question

Question 4

Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?


Group of answer choices


acid


base


neutral solution


pH indicator








first to answer gets the brinllest

Answers

Answer:

Kleenex

ekekkdkdkeeee

A frog that is dominant for its light green color mates with a brown frog and produces one small brown frog. How is this possible if the green color is dominate?

Answers

Answer:

The dominant (light green) parent was heterozygote for the trait

Explanation:

According to Gregor Mendel in his law of dominance, an allele is said to be DOMINANT if it masks the phenotypic expression of another allele in a gene. The allele being masked is called RECESSIVE allele. In this case of a frog whose allele for light green color is dominant over the allele for brown color, the light green color allele (G) is dominant while the brown color allele (g) is recessive.

However, in a cross between that have light green frog and a brown frog, a small brown frog is produced. This is possible despite the green color being dominant because the genotype of the light green dominant parent is HETEROZYGOUS i.e. it contains both light green (dominant) allele and brown (recessive) allele.

Hence, when a gamete with recessive allele (g) is produced by the heterozygous light green frog (Gg), it mates with a recessive allele from the brown frog (gg) to produce a brown offspring (gg).

Other Questions
Which of the following happened during the Second Great Awakening? Men became the driving force of the Temperance Movement. William Lloyd Garrison grew the public education system. Dorothea Dix improved the quality of life for the mentally ill. Women began to preach in white churches. Courtney walks 1 mph slower than Brandi does. In the time that it takes Brandi to walk 6.5 mi, Courtney walks 5 mi. Find the speed of each person Solve for x please: 9=8/5(x+5) Use the Distributive Property to write each expression in factored form. DO NOT determine the answer.11) 6x2+ 6x312) -6x 2 + (-6) x313) 5x - 8x list and describe 3 architectural features developed or maybe popular by the romans can someone make a poem of spring for me? I have 0 ideas (pls I have 5 other assignments for this) Jamal runs for a track team. He ran 2.1 miles in 1/3 of an hour. What is Jamal's rate of speed? Biking burns on average 185 calories everythirty minutes. PLS HELP!!!! What part of speech correlates with the following capitalized word(s) in thesentence (there is only 1 correct part of speech): He WILL BE GOING to theparty. *1.Interjection2.Pronoun3.Conjunction4.Noun5.Adverb6.Adjective7.Preposition8.Verb When you divide 2149 by n, the remainder is 4. When you divide 1578 by n the remainder is 5. What is the least possible natural number n?and other questionWhen you divide 12,650 by n , the remainder is 2. When you divide 5,800 by n the remainder is 3. What is the least possible natural number n?Bonus If you want brainly answer these 2 other questionsn is a natural number. Find the greatest possible value of the GCD of(2n+25) and (n+15)Also answer(2n+25) and (n+15) Which set of statements explains how to plot a point at the location (Negative 3 and one-half, negative 2)?Start at the origin. Move 3 and one-half units right because the x-coordinate is Negative 3 and one-half. Negative 3 and one-half is between 3 and 4. Move 2 units down because the y-coordinate is -2.Start at the origin. Move 3 and one-half units down because the x-coordinate is Negative 3 and one-half. Negative 3 and one-half is between -3 and -4. Move 2 units left because the y-coordinate is -2.Start at the origin. Move 3 and one-half units down because the x-coordinate is Negative 3 and one-half. Negative 3 and one-half is between -3 and -4. Move 2 units right because the y-coordinate is -2.Start at the origin. Move 3 and one-half units left because the x-coordinate is Negative 3 and one-half. Negative 3 and one-half is between -3 and -4. Move 2 units down because the y-coordinate is -2. The device shows the relative humidity at 22C. Whats the water vapor density if the maximum water vapor in air at this temperature is 20 grams/cubic meter?A device showing that at 22 degrees Celsius the relative humidity is 58%. please answer right will give brainliest Find the solution to the following system using substitution or elimination y = -4x + 9 y = 3x - 5 A. (1.5) B. (1-2) C. (2.1) D. (14.373 el choferLa abogada.La persona que corta el pelo.La persona que conduceLa gua turistica help with this bounds question please The least count of stopwatch is 0.2s.The time of 20 oscillations of a pendulum was measured to be 25s.Find the percentage error in the measurement of time 4. Segn el articulo, zque obstruye la movtlidad social y la reduccin de la pobreza en Amrica Latina?1.La disparidad de gnero 2. El desequilibrio educativo 3. La disparidad de ingresos 4. El mal desempeo del mercado laboral Which organism cannot perform asexual reproduction?humansfungiearthwormspotatoes help me solve this pls i make u a brainliest if it correct