Health Middle School

Traits, such as your hair or eye color, are determined by the proteins made by cells in your body. True or False?

Answers

Answer 1

Answer:

True, I took the test and got a 95

Explanation:

GOT THIS ONE RIGHT

Answer 2

Traits, such as your hair or eye color, are determined by the proteins made by cells in your body - True.

Genes

instructions are encoded on specific genes that tell your cells to make molecules called proteins. Each gene carries instructions that determine your traits, such as eye color, hair color, and height by producing a specific protein.

Genes is responsible for the production of P protein, which is responsible for the production of melanin through a maturation process of melanosomes. Melanin has a direct role in the shade of skin and hair too.

Learn more about Genes:

https://brainly.com/question/25703686

Related Questions

Explain two other facts that you found interesting from this article that you were not asked about already.
a.
b.

Answers

Hello, I can’t exactly answer the question given the fact I don’t know what the article you reas about explains. Let me know so I can help! :)
May you please post the article, therefore maybe I can help you? Thank you! (:

help
There are six dimensions of health: physical, mental, emotional, social, spiritual, and environmental. On a scale of 1-10, with 10 being optimal wellness, how would you rank each of the dimensions as they relate to your life right now, and what steps could you take to improve your overall health?
what do they mean by spiritual ;-;

Answers

well i'm not going to rate my life but spiritual mean there belief system, like some people believe god is a women, and others don't.

Answer:

Spiritual health includes a purposeful life, transcendence and actualization of different dimensions and capacities of human beings. Spiritual health creates a balance between physical, psychological and social aspects of human life.

Explanation:

Please Help???

LOOK AT THE PICTURES AND I NEED THE ANSWER FOR EVERY PLACE THAT HAS PTS IN IT.

BRAINLESS TO WHO EVER ANSWERS.

Answers

Answer:

Male physical changes:

Hair growth

Body growth

Change in voice pitch

Female physical changes:

Body chaning ( Brest growth, Hair growth)

This Allows you to:

learn and devlop

This period of time is when femals become:

More grown, Menistral cycle, sexual sensations

Emotional changes:

Confused, sad, anger

You are very self-centored:

You learn to focues on others

Friends and acceptance:

You are able to love and accept others into your life

You try to be like others:

You learn to love yourself and be who you are

You begin having more friends of both genders:

Your feelings progress towards the "friends" of gender.

You depend on others like parents and teachers  

HOPE THIS HELPSSS

The answer is male physical changes in life so good luck

what does this mean by spiritual ;-;
There are six dimensions of health: physical, mental, emotional, social, spiritual, and environmental. On a scale of 1-10, with 10 being optimal wellness, how would you rank each of the dimensions as they relate to your life right now, and what steps could you take to improve your overall health?

Answers

Answer: relating to religion or religious belief, or like your with the “spirits”.

Explanation:

by spiritual they mean your deep feelings or beliefs.

A man who maintains a healthy weight by eating a balanced diet is affecting his health in which way?
Hurry plzz

Answers

Answer:

His health is well because he eats both healthy and non healthy food.

Explanation:

Answer:

It is not affecting his health

Explanation:

He is not eating like a maniac and gaining weight

Which sends information from other parts of the body all the way to the brain?
O neuroreceptors
O sensory neurons
O sensory receptors
O neural pathways
Please help this is a test :l

Answers

neural pathways i think
neural pathways! sorry if it’s not correct

Can speaking a different language be a communication barrier?

Group of answer choices

Yes

No

Answers

Answer:

Yes

Explanation:

Answer:

True

Explanation:

Two people speaking two different languages can not communicate to each other. For example, if an American goes to Egypt. They don't understand Arabic, and most people in Egypt don't understand English. So it would be very hard to communicate to them.

So your answer is True.

Which lines is written in dialect?

Don't even think about starting another fight.
Are you wanting to pick a fight with me?
I reckon you’re itchin to fight me, ain’t you?
You’re wanting to fight me again, aren’t you?

Answers

Answer:

I reckon you’re itchin to fight me, ain’t you?

Explanation:

are you wanting to pick a fight with me

There are 2 genes that decide each of your traits, and those 2 genes are always exactly alike. True or false?

Answers

Answer: the answer is false

False.

There are 2 genes that decide each of your traits, and those 2 genes are not always alike.

A trait is a specific characteristic of an organism. Traits can be determined by genes or the environment, or more commonly by interactions between them Within these chromosomes, there are sections called genes that control specific characteristics or traits. These genes have both a dominant and recessive form.Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism.

Learn more:

brainly.com/question/9089686

_____ is released during stress and speeds up the heart.
Cortisol
Adrenaline
Estrogen
Blood Sugar

Answers

adrenaline is a hormone that is released in response to stress that speeds up the heart rate.
The correct answer is adrenaline!

In this class, you have learned many leadership skills that you can use to help yourself and others. You can use these skills now, in high school, and beyond. Now, it's up to you to find new opportunities to use your leadership training. How will you use your leadership skills to empower yourself and help others?

Assignment

Write an essay or create a video describing what you have learned in this class. Provide specific examples of how you have used at least three leadership tools or concepts. If you need ideas, take a look at the leadership guide.
Essay: Write three paragraphs. Each paragraph should have at least four complete sentences.
Or
Video: Create a two to four minute video.
Review the checklist to success.
Submit your work to 08.05 Continue to Lead.

Answers

The three skill are mentor ships strategic think and working hard probably thank me later
I took an pic of what u could say

Please help What Condition does Elisa have?
Elisa's Test Results Test Result
Total glucose molecules absorbed by cells 19
Total amino acid molecules absorbed by cells 54
Total oxygen molecules absorbed by cells 273
Oxygen molecules are taken in per breath 25

Answers

I had this in school before, She has Type 1 Diabetes, she has symptoms on it to.
She has type on diabetes

pls help asap i will give 12points

Answers

Answer:

But it says that you're giving 6-

Answer:

1. is character 2. is family values 3. is family 4. is heredity 5 is habit and 6 is family guidline

Question 1

You will be using what you've learned in this lesson to develop a personal wellness

plan to help protect yourself from both communicable and noncommunicable

diseases. Start by identifying controllable and uncontrollable risk factors for disease.

(4 points)

Communicable

Controllable

Uncontrollable

CLOSE

ge

e

.

i

e

here to search

Answers

A communicable disease is one that spreads easily from person to person.

What is communicable disease?

The question is incomplete as the lesson material is missing. However, I will try to explain the meaning of communicable and non communicable diseases.

A communicable disease is one that spreads easily from person to person e.g tuberculosis. A non communicable disease does not spread easily from person to person e.g cancer.

For a communicable disease, the greatest risk factor for contacting it is exposure to people already infected with the disease.

Learn more about communicable disease: https://brainly.com/question/943439

Some information and material is missing but I can give you the differences and the definitions and ways to protect yourself from communicable and noncommunicable

Communicable disease- A contagious disease that can spread from one person to another three direct or indirect contact

Noncommunicable disease- A chronic disease that is nottransmittable directly from one person to another, includes Parkison disease, autoimmune disease, strokes, most heart diseases, most cancers

The most common way to protect yourself from noncommunicable disease is to exercise every day physical, activity removes disease, causing toxins through sweat. It also prevent cardiovascular disease respiratory problems in reduces the risk of cancer and diabetes.

To avoid communicable diseases through self-help strategies, clean your house, thoroughly and use proper waste management, remove any stagnant water in your house avoid drinking contaminated water and eating eating street foods

Sorry if I didn’t spell something right !!!!


Which muscle fibers are best suited for sprinting?

Red fibers
White fibers
Motor-neuron cells
Yellow fibers

Answers

Yellow fibers. Why? Because Yellow fibers, are various proteins produced by fibroblasts and smooth muscle cells in the a
Yellow fibers I was thought this last year in gym
Other Questions
Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... What are the outcomes of the ice cap melting? Choose all that apply.1. Light cannot be reflected back to the atmosphere2. Sea level rises3. Absorption of solar radiation leads to increase in ocean temperature4. Ocean remains unaffected paid rent of Rs.25000 by cheque. make journal entry m2 = by the .m1 = by the .m3 = by the . please help me with thisanswer choiceThis system has infinitely many solutions.This system has exactly one solution.This system has no solution.(5, 28) and (0, 0) Gregory knows that Triangle A B C is reflected onto Triangle A prime B prime C prime. Which statement about the figures is true?If Gregory draws the segment with endpoints A and A, then the midpoint will lie on the line of reflection.If Gregory draws the segment with endpoints B and C, then the midpoint will be on the line of reflection.Points A and B are equidistant from the line of reflection.Line segment A B will be perpendicular to the line of reflection. Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? Rule-of-thumb budgeting is budgeting that's popular with the hospitality and tourism industry because it's so effective. trueorfalse can someone please answer these and explain how you did it2x - 7 = 117x + 1 = 223x - 8 = 228x +5 = 45 write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? What is the main purpose of foreign aid? Help plz... give you brainliest for who ever answers, plz need help. Financial reports are created and used to evaluate the financial performance of the business. Which function is responsible for creating the reports Describe the religions of the early Indigenous peoples. Only________ can declare war! which sea would a boat pass through traveling from South Korea to Japan Brent has to complete a final group project and his group members aren'tdoing their share of the work. Brent generally believes in being kind to others,but at the last group meeting, he was so frustrated that he yelled at the groupand threatened to stop working on the project. Which value system is mainlyin question here?A.ethics B.lawC.business lawM.morality If 10 percent of a number equals 30, find 40 percent of that number.