This is some question pizza circles in math

This Is Some Question Pizza Circles In Math

Answers

Answer 1

Step-by-step explanation:

Diameter : 10

Radius : 5

Area :

[tex]\pi {r}^{2} = \pi{5}^{2} = 78.54[/tex]

Diameter: 18

Radius : 9

Area :

[tex]\pi {9}^{2} = 254.47[/tex]

Diameter: 11

Radius: 5.5

Area:

[tex]\pi {5.5}^{2} = 95.03[/tex]

Diameter: 12

Radius : 6

Area:

[tex]\pi {6}^{2} = 113.09[/tex]


Related Questions

Helpppppppppppppppppp ILL MARK YOU BRAINLIST PLZ

Answers

Answer:

Through pythogoras theorem

a^2+b^2=c^2

20^2+16^2=c^2

c^2=400+256

c^2= 656

c= square root of 656

c=25.6 inches or 30 inches

Missing side 25.6 inches or 30 inches

c^2 = a^2 + b^2

c^2 = 16^2 + 20^2

c^2 = 256 + 400

c^2 = 656

Now, square root both sides to find the missing length of c or the hypontenuse.

Answer: c = 25.6 inches



A recent poll found that 76% of a random sample of 100 American movie goers thought the popcorn sold at the movie theatre was overpriced.

If the sample size was increased to 10,000 American movie-goers, what effect would this have on the estimated percentage of American movie-goers who

think the popcorn is overpriced?

Answers

Answer:

Step-by-step explanation:

Given that:

percentage of sample proportion = 76%

sample size = 100

Given that the sample proportion estimate is unbaised of the population proportion, then the percentage of all American movie-goers who think popcorn is overpriced is = 76%. Also, the mean of the sampling distribution appears to be independent of the sample size. Then, the estimate of the percentage will equally remain the same regardless it is even a sample of size 10000.

Plzzzzzz help meeeeeee

Answers

Answer:

-10

Step-by-step explanation:

hope it helps

Answer:

blue point value is -10

Step-by-step explanation:

First lets find the difference between each point on the line,

The gap between 10 and 2 has 2 points

So 10 - 2 = 8 is the difference in value between point A(10) and point C(2), but we need to find difference between each point,

So 8/2 = 4 is the difference between each point from top to bottom.

There is 3 points after 2 to reach blue,

So 4 x 3 = 12, is the difference in value between point C(2) and point blue,

So, subtracting 12 from 2 will get us the value of blue, 2 - 12 = -10

Therefore the value of blue point is -10

Happy to help :)

56 bananas Is what percent of
80 bananas?

Answers

Answer:

70%

Step-by-step explanation:

Branlist please!

Answer:

56 bananas Is what percent of

80 bananas?

56/80x100

=70%

x^2+16x+63=0 enter the solutions from least to greatest

Answers

X1=-9 X2=-7
First factor the equation to (x+9) • (x+7)=0
Then separate x+9=0 x+7=0 then solve for x
-9,-7.

2.) Put these decimals in order from least to greatest:
2.03, 2.30, 32, 302, .032
NEWPA

Answers

Answer: .032, 2.03, 2.30, 32, 302

This is least to greatest. ζόμπα

Answer:

.032 .302 .32  2.03  2.30

Step-by-step explanation:

A recipe says to use 3 cups of flour to make 24 muffins what is the constant of proportionality that relates the number of muffins made why to the number of cups of flour used X? HELP PLEASE!

Answers

Answer:

8

Step-by-step explanation:

24 divided by 3 =8

#9 Can anyone please help me, this is Pythagoras Theorem Converse.

Answers

Answer:

(D).

Step-by-step explanation:

[tex]A_{b}[/tex] = A + [tex]A_{s}[/tex]

(A). 12 + 16 > 20

(B). 10 + 18 < 30

(C). 4 + 5 < 12

(D). 8 + 16 = 24

19. (9x - 4)(x-6)
21. (-5x + 6)(x + 5)
23. (x2 - 8)(x + 4)
25. (x2 + 10x)(x - 3)
Help please!!

Answers

:))))))))))))))))))))))

• Mrs. Alvarez rents skis and poles for 3 days.
What is the total cost of the rental?
• The total cost of the rental is $

Answers

The value that Mrs. Alvarez will pay depends on the rental value of the ski and the poles per day, for example $144.

How to calculate the total loan cost of Ski equipment?

To know the total cost of the loan of the Ski equipment, we must know the loan price per day or per hour.

For example, suppose the loan price per hour is $2, then we would have to calculate how much one day is equivalent to and then multiply it by the total number of days.

$2 x 24 = $48

$48 x 3 = $144

Note: This question is incomplete because some information is missing. However I can answer it based on my general prior knowledge.

Learn more about ski in: https://brainly.com/question/5878485

4+6x=-3+7x

please helppp it’s due tmr

Answers

Answer:

x is equal to seven.

Step-by-step explanation:

To solve this you can move like terms to each side, then divide both sides by the coefficient of x:

4 + 6x = -3 + 7x

6x -7x = -3 - 4

-x = -7

x = 7

bet you cant answer this lol









s1 = 20, s1 = 15, s1 = 9, and s1 = 6

Answers

Answer:

50

Step-by-step explanation:

Actually it’s 51................................

Line p intersects line a and b. a b. By which theorem is a1 ≈ a8

PLEASE HELP!!

Answers

Answer:

option a

Step-by-step explanation:

alternate exterior angle theorem

4. If x=2, which equation is true?
A. 3(8-X)=18
B. 3(9-x)=30
C. 2(x-8)=24
D. 4x-8=20

Answers

Answer:

option a.

Step-by-step explanation:

3(8-x)=18

3(8-2)

3×6=18

so the RHS and LHS are equal

It’s a. 3(8-x) = 18
Just to let you know

help me, please math

Answers

Answer:

i think its c

Step-by-step explanation:

If shelly rans 3 miles each week and cam runs 8 times mora than shelly. HOW MANY miles does cam run in 3 weeks?

Answers

the correct answer is 72

During the morning commute 60 cars and 12 trucks passed through the intersection. What is the ratio of cars to trucks?​

Answers

Answer: 60:12, 60/12, or 60 to 12.

Step-by-step explanation:

To find the ratio, we must find 2 values. The values in this case is 60 and 12. 60 being cars and 12 being trucks.

So to write the ratio, we must put the cars first, then the trucks second.

So 60 first, and 12 second.

And remember, there are 3 ways to write ratios.

So we can write it like 60:12, 60/12, or 60 to 12.

The answers are 60:12, 60/12, or 60 to 12.

Michael read 135 pages in 90 minutes. Select all of the rates that have the same constant rate of change as Michael's rate. 180 pages in 2 hours 180 pages in 2 , hours 60 pages in 30 minutes 60 pages in 30 , minutes 108 pages in 212 hours 108 pages in 21 half , hours 150 pages in 1 hour 150 pages in 1 , hour 225 pages in 150 minutes 225 pages in 150, minutes 210 pages in 2 hour 20 minutes

Answers

Answer:

180 pages in 2 hours

225 pages in 150 minutes

210 pages in 2 hours 20 minutes

Step-by-step explanation:

135 pages : 90 minutes

= 135/90

= 3/2

= 3 : 2

180 pages : 2 hours

180 pages : 120 minutes

= 180/120

= 3/2

= 3:2

60 pages : 30 minutes

= 60/30

= 2/1

= 2:1

108 pages : 2 1/2 hours

108 pages : 180 minutes

= 108/180

= 18/30

= 3/5

= 3:5

150 pages : 1 hour

150 : 60

= 150/60

= 10/6

= 5/3

= 5:3

225 pages : 150 minutes

= 225/150

= 9/6

= 3/2

= 3:2

210 pages : 2 hours 20 minutes

210 pages : 140 minutes

= 210/140

= 3/2

= 3:2

PLSSS HELP MEEEEEEEEE

Answers

Answer:

Ryan's raft

Step-by-step explanation:

Ryan's raft has greater rate of change

Can someone explain how to work this out please ?

Answers

Answer:

x=4

Step-by-step explanation:

f(x) = (x-2)^5  +3

Let f(x) = 35

35 = (x-2)^5  +3

Subtract 3 from each side

35-3 = (x-2)^5  +3-3

32 = (x-2)^5

Take the fifth root of each side

32 ^ (1/5) =  (x-2)^5^ 1/5

2 = x-2

Add 2 to each side

2 +2 = x-2+2

4 =x

what is the fraction of 2 1/4

Answers

Answer:

9/4

Step-by-step explanation:

2 1/4 = 9/4 From mixed fraction to an improper fraction: "the numerator of the improper fraction" = "denominator" xx "the whole number" + "the numerator of the mixed fraction" The denominator remains as it is. So 2 1/4 = (4 xx 2 + 1)/4 = 9/4

Answer:

9/4

Step-by-step explanation:

Multiply the denominator which is 4 by the whole number which is 2.

4 x 2 = 8

Next add the numerator to the 8.

8 + 1 = 9

The 9 is now the numerator and keep the original denominator.

9/4

Find the area of a circle with radius 4ft.

Answers

Answer:

A=50.27

Step-by-step explanation:

Can someone help with this? I’m offering high amount of credits for the answers.

Answers

Answer:

jn and lp

Step-by-step explanation:

jn lp i’m so sorry if i’m incorrect

this is the choices
88
70
110
120

Answers

Answer would be 110 because if a figure has 4 angles all it's angle lengths add up to 360°, so since one of the angles is 70° and there is another angle that's identical to it, 70+70= 140, so you have to do 360-140 which gives you 220, and 220/2 = 110°

Answer:

110

Step-by-step explanation:

as a trapezoid contains of angles that add up to 360 .....and the top angles are equal and the bottom angles are equal ...therefore >v equals to 70 and w as well and x are equal to 110 each

find the measure of the missing angles

Answers

Answer:

b=80

c=80

Step-by-step explanation:

the angle opposite to the 100 degree angle is congruent to it

same goes for b and c

so far we have 2 angles that measure 100 degrees 100+100=200

the sum of the 4 angles is 360

360-200=160

160/2=80=b=c

they’re both 80 :)

because of where 100 is you can make a line where b and c are. a straight line is 180 so you subtract from 100 to get 80

2x + 1 = 9
is that the answer ?

Answers

Answer:

yes

Step-by-step explanation:

because 9-1=8/2 equals 4 so2x4+1=9

HELP ASAP EXPLAIN PLEASE

Answers

(A) The ratio is 6 to 1

A bag contains 6 red, 8 black and 10 yellow identical beads, 2 beads are picked at random one after the other.find the probability that ;

a). With replacement
i). Both are red
ii). One is black and the other yellow

b). Without replacement
i). Both are red
ii). One is black and the other yellow ​

Answers

Answer:

a)i)1/16

ii)5/36

b)i)5/96

ii)20/69

Step-by-step explanation:

a) i) 6/24 =1/4

1/4*1/4=1/16

a)ii)8/24=1/3    10/24=5/12

1/3*5/12=5/36

b)i) 5/24*1/4=5/96

ii) 1/3*10/23=10/69

5/12*8/23=40/276=20/138=10/69

10/69+10/69=20/69

The probabilities are; 1/16, 5/36, 5/96 and 20/69

What is probability?

Probability is the branch of mathematics concerning numerical descriptions of how likely an event is to occur, or how likely it is that a proposition is true.

Given that, A bag contains 6 red, 8 black and 10 yellow identical beads, 2 beads are picked at random one after the other.

a) With replacement:

i) The probability that both will be red =

6/24 =1/4

1/4x1/4=1/16

ii) The probability of getting one black and a yellow =

8/24=1/3    10/24=5/12

1/3x5/12=5/36

b) Without replacement;

i) The probability of getting both red =

5/24x1/4 = 5/96

ii) The probability of getting one black and a yellow =

1/3x10/23 = 10/69

5/12x8/23 = 40/276 = 20/138 = 10/69

10/69+10/69 = 20/69

Hence, The probabilities are; 1/16, 5/36, 5/96 and 20/69

For more references on probability, click;

https://brainly.com/question/11234923

#SPJ2

A container has 5 green, 4 yelow and 2 whhite marbles. Carla chooses a marble without looking. Is it the probability that she will select a green marble closest to 0, 1/2 or 1? What is P (white)

Answers

Step-by-step explanation:

A container has 5 green, 4 yellow and 2 white marbles.

We need to find the probability of selecting a green marble.

The probability of getting an event is given by :

P(E) = favorable outcomes/no. of outcomes

The probability of getting green marble will be :

[tex]P(G) = \dfrac{5}{5+4+2}\\\\=\dfrac{5}{11}[/tex]

The probability of getting white marble will be :

[tex]P(W) = \dfrac{2}{5+4+2}\\\\=\dfrac{2}{11}[/tex]

Hence, this is the required solution.

Write the repeating decimal $0.\overline{51}$ as a fully simplified fraction.

Answers

Answer:

17/33

Step-by-step explanation:

The repeating decimal [tex]$0.\overline{51}$[/tex] is equal to [tex]$\boxed{\frac{17}{33}}$[/tex].

What is a fraction?

A fraction is a component of a whole. Mathematically, the number is expressed as a quotient, where the numerator and denominator are divided. In a simple fraction, both are integers. In a complex fraction, a fraction can be found in either the numerator or the denominator. A suitable fraction has a numerator that is smaller than its denominator.

Let [tex]$x = 0.\overline{51}$[/tex]. Multiplying both sides of this equation by 100 gives,

[tex]$100x = 51.\overline{51}\\[/tex]. Subtracting the first equation from the second equation eliminates the repeating decimal,

giving:

[tex]\begin1100x - x &= 51.\overline{51} - 0.\overline{51}\\ \99x &= 51 \\\ \\end[/tex]

x = 51/99

Therefore, the repeating decimal [tex]$0.\overline{51}$[/tex] is equal to [tex]$\boxed{\frac{17}{33}}$[/tex].

Learn more about fractions here:

https://brainly.com/question/10354322

#SPJ6

Other Questions
write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? What is the main purpose of foreign aid? Describe the religions of the early Indigenous peoples. Only________ can declare war! which sea would a boat pass through traveling from South Korea to Japan Brent has to complete a final group project and his group members aren'tdoing their share of the work. Brent generally believes in being kind to others,but at the last group meeting, he was so frustrated that he yelled at the groupand threatened to stop working on the project. Which value system is mainlyin question here?A.ethics B.lawC.business lawM.morality If 10 percent of a number equals 30, find 40 percent of that number. RIP grandsonhow does earths crust change earths surface Christine's middle school total of 900 students and 45 teachers. The local high school has 110 teachers and a student-teacher ratio propotional to the middle school's. How many students find when she gets to high school According to the map, Italy in the early 19th century was under the control of Austria. under the control of Spain. united as the Kingdom of Italy. split into kingdoms and city-states. Calculate the heat energy needed to change the temperature of 2 kg of copper from 10C to 110C.If you could show your process and equations used, that would be very helpful! Thanks! "That ball 'bolted' by so fast." What does the word 'bolted' mean in this sentence? [2.1 + (9.2 x 3.3)] x 0.8 What is the value of 2x + 6 when x = 10? Please help a girl out PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems can produce two types of light fixtures, the indoors model and the outdoors model. if the total sales are expected to be 21,050 units, what would be the totla operating income of the company if it decides to buy the new production equipment i need help lol i forgot how to do this The value of (a1)+92 - +24,5 " when a= 2 and b=-1