The stroma is the Group of answer choices space between the inner and outer membranes of a chloroplast. watery fluid enclosed by the inner membrane of a mitochondrion. thick fluid enclosed by the inner chloroplast membrane. space between the inner and outer membranes of a mitochondrion.

Answers

Answer 1

Answer: The correct option to the question is (thick fluid enclosed by the inner chloroplast membrane).

Explanation:

Chloroplasts are surrounded by a double membrane and contain a third inner membrane, called the thylakoid membrane, that forms long folds within the organelle. In electron micrographs, thylakoid membranes look like stacks of coins, although the compartments they form are connected like a maze of chambers. The green pigment chlorophyll is located within the thylakoid membrane, and the space between the thylakoid and the chloroplast membranes is called the STROMA

The STROMA is made up of thick colourless fluid which surrounds the thylakoid and is enclosed within the inner chloroplast membrane. The stroma is essential for photosynthesis because:

--> it contains the enzymes necessary for carbon fixation,

--> it also manages the chloroplast response to cellular stresses and signaling between various organelles.

--> It plays an important role in both the light-dependent and light-independent reactions of photosynthesis.


Related Questions

What could a human living now and a dinosuar living millions of years ago have in common?

help now pls im desperate

Answers

Answer:

We both drank the same water, due to the water cycle

Or you can say: We both breathed the same air

Explanation:

This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary

Answers

C. Secondary Succession

The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.

This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.

Hope it helps you! \(^ᴥ^)/

Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.

What is a succession?

Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.

Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.

Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.

Learn more about succession, here:

https://brainly.com/question/26675203

#SPJ2

ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution

Answers

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

Is there anything we as a society can do to prevent these pandemic from occurring

Answers

The only thing you can do now is to try do the necessary pre-causion, which are;

Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancing

How does water help drive the rock cycle?

A. It is abundant on Earth's surface.

B. It is an agent of weathering and erosion.

C. It helps Earth maintain a relatively constant temperature.

D. It maintains a liquid state in a relatively narrow range of temperatures

ap3x​

Answers

The correct answer is D

Fat cells are expandable. How does this structure relate to a fat cell's function?

A) Fat cells store energy for the body to use later, so being
expandable would help with storage.

B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.

C) Fall cells protect organs, so being expandable can help with cushioning.

D) Fat cells do not expand

Answers

Answer:

Explanation:

d

Which of the following describes the products of mitosis?


two unique cells

one cell identical to the parent

cell death

two daughter cells that have identical DNA to the parent

Answers

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

que es la educación,.......​

Answers

Answer:

el proceso de recibir o dar instrucción sistemática, especialmente en una escuela o universidad.

Explanation:

espero que esto ayude!

Plyometrics can help a person maintain cardiorespiratory fitness true or false

Answers

False
Explanation: Edge

Why was the Battle of Bunker Hill important in the war for American independence from Britain? A. The battle was the first important victory for the fledgling Continental Army. B. The battle was the first important victory for General George Washington. C. Although the British ultimately won the battle, they lost their best general. D. Although the British ultimately won the battle, they suffered heavy casualties.

Answers

Answer: D. Although the British ultimately won the battle, they suffered heavy casualties.

Explanation: Even though they lost, the colonial forces were able to inflict a substantial amount of damage resulting in lots of casualties.

Which is a compound?

Answers

Answer:

A thing that is composed of two or more separate elements; a mixture is called compound.

Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?

1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium

Answers

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *

erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits

Answers

Answer:

1) erodes

2)deposits

Explanation:

Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary

Answers

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

m is the mass of the object.g is the acceleration due to gravity.

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

Which of the following could occur as the result of runoff of high nitrogen fertilizers from farmlands near a lake?
O an increase in algae growth resulting in low oxygen levels in the lake
O a decrease in mineral storage reducing carbon levels of the lake
O a decrease in pollution in lower ozone levels in the lake area
O an increase in deforestation reducing animal populations in the lake area

Answers

Answer: the first one an increase in aldae

Explanation:

John Needham, Louis Pasteur, and other scientists all performed experiments to disprove ______.
a) spontaneous generation
b) evolution
c) Koch's postulates
d) binomial nomenclature

Answers

Answer:

A) spontaneous generation

Explanation:

Spontaneous Generation theory stated that living organisms could be spontaneously generated from non-living matter. Francesco Redi conducted an experiment similar to the one Louis Pasteur would do nearly 200 years later. The 17th-century Italian developed a spontaneous generation experiment that showed that maggots do not spontaneously emerge from decaying meat.

MARK THIS ANSWER BRAINLIEST PLEASE ❤️

The theory of spontaneous generation is an experiment that tries to prove the possibilities that living organisms can be produced from non-living origins.

This experiment was first done by Francesco Redi in 1668. However, several scientists such as John Needham, Louis Pasteur, John Tyndall amongst other scientist tried to disprove the theory of spontaneous generation.

The theory was later disproved by Louis Pasteur and John Tyndall in the mid-19th century.

Read more about spontaneous generation at:

https://brainly.com/question/2003717

1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?

2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?


3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?




4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?





5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.



6. Is this microbe normal microbiota at the culture site?




7. What type of treatment would be used for this patient

Answers

Answer:

All the answers are there in the photo

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Answers

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Which is a positive effect of wildfires?

Answers

Answer: it lets for room for more buildings to be built

Explanation:

Hi! A positive effect of wildfires would be there is now cleared land that can be used for other projects along with other resources. I hope this helped, Goodluck :)

which statement is true of both mitosis and meiosis?

A) The number of
chromosomes is reduced by half.

B) both occur only in reproductive cells.

C) DNA replication occurs before the division of the nucleus.

D) both are involved in asexual reproduction.

Answers

Answer:

The statement 'b. both occur only in reproductive cells' is true

I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural

Answers

What are the answer choices

Which is NOT a passive transport mechanism across the membrane of a plant cell?


Which is NOT a passive transport mechanism across the membrane of a plant cell?

Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis

Answers

Answer:

the company has also announced plans

If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?

Answers

Answer:

True

Explanation:

Because for each death someone is born

It's like 1+1+1-1-1=1

The answer is the same

what type of food is made during photosynthesis

Answers

Answer:

glucose

Explanation:

Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light

(bbc)

glucose
Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light.

g Two linked genes, (A) and (B), are separated by 18 centiMorgans. A man with genotype Aa Bb marries a woman who is aa bb. The man's father was AA BB. What is the probability that their first child will both be ab/ab

Answers

Answer:

The probability that their first child will both be ab/ab = 41%.

Explanation:

Available data:

Two linked genes  (A) and (B) ⇒ 18 centiMorgans apartMan ⇒  Aa BbMan´s father ⇒ AA BBWoman ⇒ aabb

The recombination frequency is given by the distance between genes. We have to know that 1% of recombinations = 1 map unit = 1cm.

Recombination frequency = 0.18

Man: AaBb

Gametes) AB Parental

                 ab Parental

                 Ab Recombinant

                 aB recombinant

18 centi morgan = 18 % of recombination in total  

                            = % aB + % Ab  

                            = 9% aB + 9% Ab

       100% - 18% = 82% of parental in total  

                           = % of AB + % ab  

                           = 41% AB + 41% ab

The frequency for each gamete is:

AB 41%

ab 41%

Ab 9%

aB 9%

Cross: man x woman

Parental)          AaBb           x          aabb

Gametes) AB, Ab, aB, ab        ab, ab, ab, ab

Punnett square)     AB ( 41%)       Ab (9%)      aB (9%)       ab (41%)

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

F1) 41% of the progeny is expected to be AaBb

     9% of the progeny is expected to be Aabb

     9% of the progeny is expected to be aaBb

     41% of the progeny is expected to be aabb

Biology
what is carbohydrates

Answers

Answer:

Simple carbohydrates are broken down quickly by the body to be used as energy. Simple carbohydrates are found naturally in foods such as fruits, milk, and milk products. They are also found in processed and refined sugars such as candy, table sugar, syrups, and soft drinks.

The sun is a natural resource used by people. Why is the sun considered a renewable resource? *

the sun goes away at night and then comes back in the morning
on cloudy days, the sun cannot be used
solar energy from the sun is limited
the sun is an unlimited source of energy that isn't used up as fast as people use it

Answers

Answer:

Because the earth continuously receives solar energy from the sun, it is considered a renewable resource.

Explanation:



A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent

Answers

Answer:

B. DENSITY INDEPENDENT

Explanation:

Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.

During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:

a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over

Answers

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?

Answers

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

Other Questions
answer plz plz plz plz plz Japanese leaders are concerned about the country's aging population and declining birth rate because A) an aging population means that Japanese society will become less dynamic than in the past. B) an aging population means that government services for the elderly will be increasingly utilized. C) a declining population would result in a loss of membership in international economic organizations. D) a declining birth rate means that fewer workers will be expected to support greater numbers of elderly, placing a financial burden on the workers. Which number is between match each sentence with the correct demonstrative adjective to complete it The graph makes it appear that there are how many times as many students per teacher at North HS as there are atWest HS?Student Teacher Ratios at Area High SchoolsNorth RSEast HS13West HS12141822a.b.102 times3 times4 times5 timesC.d. PLEASE HELP!!!!! Do you believe WWI was a Total War? Use specific details to support your answer. (15 marks) recommendations on how sports personalities are potrayed by the media can be addressed Alex was trying to determine how much money he owed the bank. Since his checking account has a balance of -155 dollars, he thinks that he can find the absolute value of -155 to determine that he owes the bank 155 dollars. Is Alex correct? Flax plant a capital good, natural good, or human good NEED HELP ASAP !!!! SOMEONE HELP ME What did Moon SHadow's mom write to him? People who practice ______read the Torah for guidance.A: HinduismB: ChristianityC: IslamD: Judaism Help me to do this question Find the missing measurement in this parallelogram.Can someone please help?????I must show the work A toy store's percent of markup is 45%. A model train costs the store $50. Find themarkup. Which is a compound? work out 8^1/3^1/3 = power Five schools are going to send their baseball teams to a tournament, in which each team must play each other team exactly once. How many games are required The relationship between peasant and noble could be compared to the relationship between vassal and noble because...a.both peasants and vassals were tied to the land of the manorb.both relationships involved agreed upon duties and responsibilities of each personc.both relationships benefited only the person of the higher classd.they all sent their sons to learn how to become knights When mounted and framed, your photograph should not touch what? The mat The display board The glass All of the above