The offspring from asexual reproduced organisms are?

Answers

Answer 1

Answer:

Asexual reproduction produces offspring that are genetically identical to the parent because the offspring are all clones of the original parent. A single individual can produce offspring asexually and large numbers of offspring can be produced quickly.

Explanation:

(not sure if this is what you wanted)


Related Questions

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Deoxyribose (sugar). Total number in image?

Answers

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

What is the Florida state lizard (don’t search) just guess

Answers

Its uhm the iguana right?

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?

Answers

Answer:

the parents are (Tt) and each passed down the recessive allele so the child is  (tt)

Explanation:


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Substance A is a gas and substance B is a liquid, They are at the same temperature why is one gas and one a liquid

Answers

Difference in boil points between both substances

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.

Answers

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

Other Questions
A ______ is a comparison of two quantities. ratios can be a part-to-part,part-to- _______, or whole -to- __________ comparisons. ratios can be written with the word _____, with a _______, or as a ___________. Find the length of side x in simplest radical form with a rational denominator.45X45V8 If you read Virginia Conversation please help me What was the familial relationship between the Emperor Napoleon I and Napoleon III? Solve for x 19/10 = x/12 The portrait of Sin Sukju, created in the fifteenth century, reflects the impact of Confucianism on Korean artistic traditions with its focus on compassion, self-awareness, and enlightenment with its focus on compassion, self-awareness, and enlightenment A with its emphasis on the Way and yin and yang, the balance of opposites with its emphasis on the Way and yin and yang, the balance of opposites B with its focus on connecting to powerful spirits in the natural world with its focus on connecting to powerful spirits in the natural world C with its emphasis on duty, loyalty, respect, and ancestor worship 4x4 Thhhhhhaaannkkkk uuuuu WHATS THE LENGTH ROUND TO THE NEAREST 10th if NEEDED 5. Amaris buys a car for $12,000. Each year it decreases invalue by 5%. Write an equation to represent the value of thecar after t years. Why were state run schools important to Stalin's communist goals proxemics involves a sense of how much Blank there is between you What is the approximate average rate of change for the function f(x)from x = 3 to x = 6?12(1.25) Please help me pls ASAP thank YOUU Find the volume of a sphere with a radius of 5 in. Round to the nearest hundredth.A) 53.05 in3 B) 104.72 in3 C) 392.70 in3 D) 523.60 in3 Will BAINLIST!!!!The circle with center C was used as a model for a hot tub. The length of is 2 m. What is the circumference of the hot tub? If a bunch of keys represents a cell, what does each key in the bunch represent? An atom A molecule A tissue An organWill give Brainliest Mathhhhhhhhhhh which one is correct What did Mary Beth and John Tinker do at school that was found to be a protected form of expression by the Supreme Court? 3. Rewrite the following sentences into reported speech (5 marks)a. There is a typhoon coming in the India Ocean.b. I have never seen rain in this area.c. They will go for shopping day after tomorrow.d. We saw a pack of wild dogs on the road.e. There are many tribes living in this area. Please help! IF YOU READ, "THE OUTSIDERS" THEN THIS IS FOR YOU! I WILL GIVE YOU 20 POINTS AND ANY FAKE ANSWERS I WILL REPORT THANK YOU VERY MUCH! In Chapter 8 Ponyboy calls Cherry a traitor, but he quickly forgives her. He asks her if she can see the sunset on the West Side, and when she says she can, he tells her to remember that he can see it on the East Side too. Explain the significance of this scene as it relates to the Greasers and the Socs. What was Ponyboy trying to get Cherry to understand?