the definition in a cladogram

Answers

Answer 1

Answer:

a branching diagram showing the cladistic relationship between a number of species


Related Questions

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

A group of coordinately regulated structural genes with related metabolic functions, plus the promoter and operator sites that control their transcription, is called a/an ___________.

Answers

Answer:

They are called promoter and regulatory genes.

Explanation:

There are different genes responsible for regulating transcription:

These are the inhibitors, promoters and regulators.

Regulatory genes are in charge of regulating that promoter or inhibitor genes remain intact or do not present mutations.

Promoter genes promote cell replication, hence transcription.

In the case of malignant or benign neoplasms, there must be yes or if the affection of a regulatory gene plus the affection of an inhibitory or promoter gene.

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

Tara placed a grape in a solution, after sometime she noticed that the grape started to shrink.
a. Name the solution and explain.
b. Then Tara placed the raisin in a solution and noticed it started to swell up. Name the solution and explain

Answers

Answer:

a. Hypertonic solution

b. Hypotonic solution

Explanation:

There are basically 3 types of solutions in biology,

1) Isotonic-Same concentration of solute and solvent inside  the grape and in the solution.

2)Hypotonic solution-More concentration of solvent in the solution than in the grape.

3)Hypertonic solution-More concentration of solvent in the grape than in the solution.

Now,

a. Tara had kept the grape in a hypertonic solution. The solvent will start draining from the grape to equalize the concentrations of solvent inside and outside. So, the grape shrank due to loss of water.

b. Tara kept it in a hypotonic solution. The solvent will start entering the grape to equalize the concentrations of solvent. So, the grape started swelling.

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

Other Questions
state two points to explain why do you think communication is important Profesora:Eric ;Profesora: Me vaEric: Me vaEric.profesora! CmoY a ti, cmo assume that autonomous consumption is $1610 billion and disposable income is $11,200 billion. Using the consumption function, calculate consumption expenditure dejar,encantar,gustar,ir,llover,poder,sorprender,volver,Question 1 with 8 blanksOMAR Sabes? El concierto al aire libre fue un xito. Yo crea que (1) 1 of 8, pero hizo sol.NIDIA Ah, me alegro. Te dije que Jaime y yo (2) 2 of 8, pero tuvimos un imprevisto (something came up) y no pudimos. Y a Laura, la viste all?OMAR S, ella fue. Al contrario que t, al principio me dijo que ella y su marido no (3) 3 of 8 ir, pero al final aparecieron. Necesitaba relajarse un poco; est muy estresada con su trabajo.NIDIA A m no me (4) 4 of 8 que lo dejara. Yo, en su lugar, (5) 5 of 8 esa compaa y (6) 6 of 8 a escribir poesa. En realidad no necesita el dinero.OMAR Estoy de acuerdo. Oye, esta noche voy a ir al teatro. (7) 7 of 8 ir conmigo? Jaime tambin puede acompaarnos. Es una comedia familiar.NIDIA A nosotros (8) 8 of 8 ir. A qu hora es?OMAR A las siete y media.I need the correct verb format with the word bank above matching the correct sentence Evaluate without actual multiplication 1) 95x96 2)103x107 Read the excerpt from The Ancient City.Why does the author include details about two typesof tunics?The basic article of clothing was the tunic. There weretwo types. The exomis, worn by slaves and thosedoing manual work, was fastened at the left shoulderwith a pin or knot, leaving the right shoulder bare, andwas tied at the waist with a girdle. The chiton was amore refined version, fastened at both shoulders.O to demonstrate that new fashions were important inrefined Greek cultureO to show that clothing style depended on a person'srole in societyto illustrate that women and men wore differentkinds of clothingO to explain that Greek-style tunics were also worn bypeople in other societies Solid sodium iodide is slowly added to a solution that is 0.0050 M Pb 2+ and 0.0050 M Ag +. [K sp (PbI 2) = 1.4 10 8; K sp (AgI) = 8.3 10 17] Calculate the Ag + concentration when PbI 2 just begins to precipitate. Do you agree or disagree with should school screen 3. The International Monetary Fund (IMF) and the World Bank are two institutions that have outlived their usefulness. Do you agree? Fill in the blank with a constant, so that the resulting quadratic expression is the square of a binomial. $\[x^2 + 22x + \underline{~~~~}.\]$ A parent increases a childs monthly allowance by 20% each year. If the allowance is $8 per month now, in about how many years will it take to reach $20 per month? Use the equation 20 = 8(1.2)x to solve the problem. Round to the nearest year. 1 year 5 years 2 years 16 years The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland. Which table shows a proportional relationship between a and b?.b39412520B.Qub202524303240.ab412un15624D.ab What is the molarity of a 50.0ml aqueous solution containing 10.0 grams of hydrogen peroxide H2O2 Is there any impotent events that are in the book Bonemender? How do employers generally respond to poor economic times? A. Raising the prices of goods to make back money B. Lowering the price of goods so people will buy C. Higher more people at low wages D. Cutting workers wages to make up for losses A car is driving at 99 km/h, calculate the distance it travels in 70 minutes.Give your answer in correct SI units rounded to 0 decimal places. The production department is proposing the purchase of an automatic insertion machine. They have identified 3 machines and have asked the accountant to analyze them to determine the best average rate of return.Machine A Machine B Machine CEstimated Average Income $45,192.56 $64,695.00 $60,929.70Average Investment $322,804.00 $215,650.00 $406,198.00Select the correct answer.a) Machine B or C b) Machine A c) Machine C d) Machine B i need help with this question In terms of market efficiency, short selling most likely: Group of answer choices leads to excess volatility, which reduces market efficiency. has little effect on market efficiency because short sellers face the risk of unlimited losses. promotes market efficiency by making assets less likely to become overvalued.