the arctic region is a treeless plain with frozen ground. true or false

Answers

Answer 1

Answer: Its True, They are largely treeless because its the arctic.


Related Questions

What is meant by trophic levels?

Answers

Answer:

The position it holds in the food chain

Explanation:

A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

The transfer of pollen from one flower to another flower on the same plant is known as​

Answers

Answer:

Cross-pollination.............

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

Please can anyone help me in question 2&3

Answers

Answer:

2. Reflex action ( transmitting of nerve impulse)

3.Excitory

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.

ITS C

Answers

Then answer is letter C

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

is planting trees in a forest In an investigation into the role of plants in the cycling of matter, a researcher is designing an experiment in which plants will be grown under conditions that will limit the rate of photosynthesis. Which design would match the goal of the researcher? M. Grow the plants in a low oxygen environment and measure the rate of carbon dioxide production. P. Grow the plants in a low carbon dioxide environment and measure the rate of oxygen production. R. Grow the plants in soil containing excess water and measure the rate of transpiration. S. Grow the plants in soil containing excess nitrogen and measure the rate of plant growth. Bi​

Answers

Answer:

S

Explanation:

The growth of plant can be measured using the starch produced.

pollination of a flower or plant with pollen from a different flower or plant is known as​

Answers

Answer:

Cross-pollination

Explanation:

cross-pollination is when pollen from one plant gets transported to another plant.

self-pollination is when pollen gets transported from the anther to the stigma of the same flower or a different flower on the same plant.

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

A planet has less mass than a galaxy and more mass than the star it orbits.
True
False

Answers

Answer:

False is your answer


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

The climate influences ________
A. Plant growth
B. Biodiversity
C. Adaptions of land organisms
D. All of the above

Answers

Answer:

D

Explanation:


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Deoxyribose (sugar). Total number in image?

Answers

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

Please help.................

Answers

Answer:

C i think.......................................

What are some ways you think scientists can affect or utilize the genes of organisms?

Answers

Answer:

I'm not quite sure what your looking for

Explanation: scientists can take the genes of one successful crop, animal, etc, and insert that gene into future things so all offspring will be successful. This is called genetically modifying. Another thing scientists can utilize genes for is cloning. There have been ideals of the perfect human for many years and now scientists are trying to alter these genes to have perfect offspring according to your standards.

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

What is another type of clean energy?

Answers

wind energy is a clean energy source
Other Questions
One meaning of insolent is "insulting, rude or contemptuous."Based on this definition, what is the most likely definition of insolence?full of respectbeing disrespectfulapologizing for being rudehaving a civil attitude Select the communication type that is being used in the following example.Two coworkers near the copy machine are discussing the upcoming company meeting.o external formal communicationo external informal communicationO internal formal communicationO internal informal communicationThing steady callin' my phoneI done told you before that it's over, leave me 'loneKnow it's hurtin' you to see me goneDark clouds, you gon' see me stormI won't go backBut trust me, you're gon' hold thatHold that Factor the binomial b^2 - 9 At the school book fair 3/5 of the books are nonfiction books. Of the nonfiction books 1/4 are animal books. What fraction of the book are animal books? what is the answer to 2 1/2 x 1 2/5 Twice the product of 6 and 5 is three times as great as this number.what is the number it's all on the picture A prism has a volume of 405 cubic inches.4.5 in.15 in.Which is the correct substitution for finding the height of the prism? helppppppp In the Soviet Union, large farms were _______.a.the last form of privately owned business.c.entirely owned and operated by the stateb.extremely lucratived.These specialists were given a portion of the profits. Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down Why is a dwarf planet not classified as a planet?It orbits larger planets.It does not clear the neighborhood around its orbital.It does not have enough mass to become spherical.It does not orbit the Sun. Which statement describes the word iterative? Which types of graphs are best used when representing individual data points rather than categories?line graphbar graphline plotstem-and-leaf plot write an expression for b divided by 6(please only real answers, I am already failing I don't need more bs) Janea bought a motorcycle for dollars. It depreciates by a factor of each year. Which expression best predicts the value of the car after 10 years? Please help solve correctly. NO links or files. Correct answers only if not report. I will even give an additional 10 if correct. HURRY PLEASE IM NEED HELP!!!!!! Anybody good in history? & wanna help me? Free Brainliest and points... (HELP I BEG ILL GIVE BRAINLY IF U WANT, ITS MULTIPLE CHOICE)