Survey Question to Americans: Should the United States enter into World
War II?
Survey Responses:
September December
1939 1941
YES
42% 91%
NO
48% 7%
No opinion 10%
2%
What statement BEST explains the changes seen in the chart?
O A. The attack on Pearl Harbor changed the vast majority of opinions
about staying out of World War II.
OB. Germany's attack on Great Britain convinced Americans that it was
time to enter World War II.
O c. With the possibility of Great Britain being defeated by Germany,
Americans wanted to join World War II.
O D. With President Roosevelt's growing popularity, the majority opinion
in the country was to join World War II.

Survey Question To Americans: Should The United States Enter Into WorldWar II?Survey Responses:September

Answers

Answer 1

Answer:

I'd say A.

Explanation:

Answer 2

Answer:

a

Explanation:


Related Questions

Which of the following is true of regions?
A
Everyone within one region speaks the same language.
B
A region may include areas that have the same climate and different histories,
languages and landforms.
с
A region might not be connect by any shared feature or characteristic.
D
Areas in one region will not have any features or characteristics in common with
areas in other regions.

Answers

B seems the best, A isn’t specific enough, it’s about sharing cultures as well other than just languages or landforms

in which city Gentleman's agreement signed? please help!​

Answers

Answer:

it was signed in 1907 between japan and united states

The Gentlemen's agreement of Andhra Pradesh was signed between Telangana and Andhra leaders before the formation of the state of Andhra Pradesh of India in 20 feb- 1956. The agreement provided safeguards with the purpose of preventing discrimination against Telangana by the government of Andhra Pradesh. The violations of this agreement are cited as one of the reasons for formation of separate statehood for Telangana.

You need to have at least $400 to afford the new PS5. You already have $150 saved up. You work after school for $20 an hour. Which inequality represents how many hours you need to work to have at least $400? /You need to have at least $400 to afford the new PS5. You already have $150 saved up. You work after school for $20 an hour. Which inequality represents how many hours you need to work to have at least $400?

Answers

I believe it’s the second one because it shows the greater than sign and you would want to have more money rather than less.

In your opinion - was the development of the "American" economic system an important change in the way the United States economy developed? There were three specific "parts" of the "Market Revolution" in early 19th century America – of these three - which was the most important? Explain why you believe this to be true.

Answers

The correct answer to this open question is the following,

In my opinion, the development of the "American" economic system was an important change in the way the United States economy developed.

There were three specific "parts" of the "Market Revolution" in early 19th century America. Of these three, the most important were the technological innovations invented in order to develop mass production. Yes, the Industrial Revolution was characterized by a series of inventions that developed new machines that allowed mass production in the factories. And for me, that was the most important element of the three.

In the mid-1800s, the market revolution had changed the way Americans produced goods. New factories introduced new machinery to simplify the production process, producing more goods in less time, at much more affordable costs. This, with the improvement of the transportation systems such as the railroad and years later, teh Transcontinental Railroad that connected the East and the West coast of the United States, helped to change the face of trade in America.

wich Weathering Factors​

Answers

Answer:

Atomic models are important because, they help us visualize the interior of atoms and molecules, and thereby predicting properties of matter.

Explanation:

We study the various atomic models in our course of study because, it is important for us to know, how did people come to the present concept of an atom. How did physics evolve from classical to quantum physics.

All these are important for us to know and thus, knowledge about various atomic models, their discoveries and drawbacks and finally improvements based on scientific evidence present at that time is important for us to understand the underlying theory very well.

what was the famous union in the 1800s? PLZZ HELP ASAP

Answers

Answer:

Answer

Explanation:

the National Labor Union

Most notable were the National Labor Union, launched in 1866, and the Knights of Labor, which reached its zenith in the mid-1880s.

The National Labor Union

Hope this helps!

What term is used to describe words with similar meanings?

antonyms
context clues
definitions
synonyms

Answers

Answer:

I believe the answer would be D. (synonyms)

Explanation:

Edg 2020-2021

By using synonyms term is used to describe words with similar meanings. that has a similar meaning to another word or almost so.

What are synonyms?

The term synonyms refer to that, A term, morpheme, or phrase that in a particular language has the exact same meaning as another word, morpheme, or phrase is said to be a synonym. For instance, the words begin, start, commence, and initiate are all synonyms.

A synonym is a term that is identical to another word (or has nearly the same meaning). Stunning and enticing, for example, A word or phrase is considered to be a synonym if it has the same meaning as another word or phrase.

Therefore, The right option (D) is correct.

Learn more about the synonyms here:

https://brainly.com/question/28598800

#SPJ6

In a mortgage, the amount of money borrowed is called the
interest
fee
point
principal

Answers

Answer:

principal

Explanation:

*principal - the amount of money borrowed.

*interest - the money paid for the privilege of using the lender's principal.

*term - the period of time over which the loan is repaid.

Select all that apply. Which of the following are examples of a traditional economic system? Little changes from generation to generation It is based on agriculture, handicraft production, and trade Central planners choose the factories that will produce the goods Everyone shares in the work Goods are produced and distributed is determined by custom and tradition​

Answers

Answer:

Little changes from generation to generation.

It is based on agriculture, handicraft production, and trade.  

Everyone shares in the work.

Goods are produced and distributed is determined by custom and tradition.

Explanation:

I used this answer and got it right it might be different for you tho

Answer:

A,B,D,E

Explanation:

help! i only have 30 min

Answers

Answer:

The Monguls definitely, he Mongol leader Kublai Khan had established the Yuan dynasty in China and crushed the last Song resistance. Manchu, also called Man, people who lived for many centuries mainly in Manchuria (now Northeast) and adjacent areas of China and who in the 17th century conquered China and ruled for more than 250 years. It is D.

Credits to Yahoo.

Question 4 of 10
Mark Twain quoted Napoleon as saying, "Tête d'armée" (Head of the army) in
order to:
O A. further explain a difficult idea.
B. support a minor point.
C. suggest what other great men should say.
D. give an example of a great man's dying words.

Answers

Answer:

It's D hope this helps you

misdemeanors do not use a pre-trial hearing or grand jury.?
A.true
B.false

Answers

Answer:

true

..................

The correct answer is B. False. They do go to a pre trial hearing

What led to Indian independence from Great Britain?

Answers

Answer:

answer is in the picture

how did the Magna Carta affect the decline of the Manor System

Answers

Explanation:

The Magna Carta was indeed a signed contract that restricted the king's authority while bolstering nobles' interests. The Magna Carta came on a much wider meaning as feudal system faded, contributing to English ideas concerning personal liberty.

What does Thomas Hobbes describe would happen if there were no government?​

Answers

Answer:

Thomas Hobbes said life without government would be "solitary, poor, nasty, brutish, and short." According to Hobbes, humans naturally compete for territory, resources, and power. Citizens vote on each issue proposed to the government.

Explanation:

Which of the following was immediate effect of the end of the Mexican-American War in 1848?

A- Spain sends resources to Mexico
B- the USA gains a lot of new territory
C- the USA surrenders to Mexico
D- Mexico and Spain rejoin forces

Answers

I think the answer is a, I’m not sure.
The answer should be B “ the USA gains a lot of new territory”

I think this because at the end of the Mexican-American war the US gained huge new pieces of land.

FROM THE MOVIE POMPEII:THE LAST DAY
What happened to the column of smoke and ash from the volcano?
a. It disappeared
b.it turned into lava
c. it fell and started going on the ground towards the city
d. It turned into rain

Answers

Answer: Letter C

Explanation:

What is one difference between Thomas Jefferson and Alexander Hamilton?

a. Hamilton wanted free public education for all, Jefferson did not.

b.Jefferson believed that the debts of the old Congress of the Articles of Confederation

should be paid by the new government, Hamilton did not.

c.Hamilton was considered a liberal, Jefferson was not.

d.Jefferson feared a strong central government, Hamilton did not.

Answers

Answer:

I believe it's B I apologize if I am incorrect.

Explanation:

Answer:I believe its D  and maybe B

• What if you were a european? Would your opinion of colonial soldiers have
changed?

Answers

Answer:

No. I'll still see them as fighting for what they believe should be their own or benefit from.

Explanation:

if I were to be a European, I would still hold the opinion that the colonial soldiers were only fighting for what they believe should be their own or benefit from.

This is because the colonial soldiers or settlers were fighting for their independence, which they deserve then.

While war is not the only answer to independence agitation, it is inevitable at the time and on each side. mist fight the war

Does government have a moral obligation to assist nations in need?

Answers

Answer: Aiding poor or struggling nations is really nice, But no they don't have to. But the citizens of a rich nation you can argue have the moral obligation to do so.

Explanation:

The diagram shows a geographic feature.
Based on the diagram, structure X is
A
a delta that is changing due to sediment deposits from ocean currents.
B
an island that is changing due to the movement of plate boundaries.
с
a delta that is changing due to sediment deposits from a river.
D
an island that is changing due to increasing volcanic lava flow.

Answers

Answer:

C

because b and d are wrong, and a is also wrong because sediments usually come from the river not an ocean

Answer:

C

Explanation:

Please please help!! i’m being timed

Answers

Answer:

The French demanded that the United States provide France with a low-interest loan, assume and pay American merchant claims against the French, and lastly pay a substantial bribe to Talleyrand. The U.S. envoys were shocked, and also skeptical that any concessions would bring about substantial changes in French policy.

Explanation:

just give me brainllest if its correct

what treaty was signed in 1895 ending the war between China and Japan​

Answers

Answer: The Treaty of Shimonoseki

Explanation: The Treaty of Shimonoseki, ending the war between China and Japan in April 1895, gave Japan political and territorial advantages which were to play a major part in the international relations of the region in the next fifty years: a new power base from which to deal with Korea; the acquisition of Taiwan as a colony; ... hope this helps. Can u give me brainliest

. What were the THREE MAIN POINTS in The Monroe Doctrine 30 points

Answers

Answer:

the United States would not interfere in the internal affairs of or the wars between European powers; (2) the United States recognized and would not interfere with existing colonies and dependencies in the Western Hemisphere; (3) the Western Hemisphere was closed to future colonization

Explanation:

10 POINTS ASAP I WILL mark as brain list if right
Although the assassination of Franz Ferdinand was a local political action, its consequences were:
A. Minor.
B. Predictable.
C. Temporary.
D. Global.

Answers

C is the correct answer

Answer:

The answer is D

PLEASE! NEED ASAP WILL GIVE BRAINLIEST AND NO LINKS

Create 6 telegraph messages explaining the exports from the following countries of Egypt, the amazon/congo basin, west africa, peru and chile, argentina and uruguay, and africa. In the telegraph, describe what the goods are to be used for in the home country of england

Answers

Are you still needing this?

I believe that years ago the universe was one giant atomic mass. In the center was the burning core that heated the atoms, causing them to vibrate which produced more heat. Eventually the mass overheated, causing a cataclysmic explosion. Creating the galaxies we know today. The galaxies are slowly moving out and apart from each other, and eventually there is still the center of gravity where the atomic mass was. And eventually the gravity will pull the galaxies together again, restarting the cycle. I call this theory the Universal Breathing Process (UBP).

Answers

Answer:

That could be, similarily to how a star functions and explodes in a super nova.

Explanation:

You should do research because there are theories and studies similar to that, so you could potentially add on to your theory.

What are the Hopewell best known for?
O A. Astronomy
O B. Large burial mounds
C. Pottery
O D. Cliff dwellings

Answers

B. Large burial mounds!

describe the purpose and origin of the acequia systems of new mexico. Explain how the acequias are managed and maintained.

Answers

Answer:

Explanation:

New Mexico. They have deep roots in two ancient traditions—Pueblo Indian and Spanish. The Pueblos collected and shared water for centuries before the arrival of Spanish colonists in 1598. ... The ditches of each acequia system bring water from a spring, river, or mountain stream to a community.

please in timed and need help

Answers

Answer: can't see it please fix first

Explanation:

Other Questions
1) How many organs of central government are there? Name them A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 How does the blood in the pulmonary artery compare to the blood in the arteries of the systemic circulatory system? What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= Samuel needs to import information from Excel to an Access table, but he wants to ensure that if the source table ischanged, the information in Access will be updated automatically. What should he do?O Create a new copy of the Excel spreadsheet and import itO Create a linked copy of the Excel spreadsheet.O Create a linked database and merge it with the Excel spreadsheet.O Create a new database and import the Excel spreadsheet. May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Can someone please help me fix the errors?Please don't answer if you don't know Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking