suppose we want to choose 6 letters without replacement from 13 distinct letters. A) how many ways can this be done if order does not matter? B) how many ways can this be done if order of choices matters

Answers

Answer 1

Answer: A) 1716   B) 1235520

Step-by-step explanation:

If order doesn't matter , then we use combinations, where the number of combinations of selecting r things from n is given by :-

[tex]^nC_r=\dfrac{n!}{r!(n-r)!}[/tex]

If order matters , then we use permutations, where the number of permutations of selecting r things from n is given by :-

[tex]^nP_r=\dfrac{n!}{(n-r)!}[/tex]

Given, Total distinct letters = 13

To choose = 6 letters

A) Number of ways to choose (if order does not matter)=[tex]^{13}C_6[/tex]

[tex]=\dfrac{13!}{6!7!}=\dfrac{13\times12\times11\times10\times9\times8\times7!}{(720)\times 7!}\\\\= $$1716[/tex]

B) Number of ways to choose (if order matters)=[tex]^{13}P_6[/tex]

[tex]=\dfrac{13!}{7!}=\dfrac{13\times12\times11\times10\times9\times8\times7!} 7!}\\\\= $$1235520[/tex]

Hence, A) 1716   B) 1235520


Related Questions

Question 3 Multiple Choice Worth 2 points)
04.04
The swimming team has competed in 45 races this season. They have won 30 races so far. How many races will the team need to win today for the team to have a 75%
Success rate?
8
10
12
15

Answers

Answer:

Total number of matches need to win = 15

Step-by-step explanation:

Given:

Total number of race completed = 45

Total races win = 30

Success rate = 75% = 0.75

Find:

Total number of matches need to win

Computation:

Assume, extra number of matches = y

Extra number of win matches = x

So,

(30 + x) / (45 + y) = 0.75

Assume y = x

So,

(30 + x) / (45 + x) = 0.75

30 + x = 33.75 + 0.75 x

x = 15

Total number of matches need to win = 15

After Marshall's alarm went off, he spent 3/4 hr getting ready for school. He walked 1/6 hr to the bus stop, waited 1/12 hr, rode1/4 hr, and arrived at school at 8:30 A.M..What time did his alarm go off?

Answers

Answer:

7:15 am

Step-by-step explanation:

1. Add the times together by finding a common denominator

3/4 = 9/12

1/6 = 2/12

1/12 = 1/12

1/4 = 3/12

9/12 + 2/12 + 1/12 + 3/12 = 15/12

It took him 15/12 of an hour in total.

2. Convert to hours

15/12 = 1 3/12

3/12 = 1/4

1/4 of an hour is 15 minutes.

I took him a total of 1 hour and 15 minutes.

3. Subtract 1 hour and 15 minutes from 8:30

8:30 - 1:15 = 7:15

Combine the radicals. 3√5-8√5+2√5

Answers

Answer:  [tex]-3\sqrt{5}[/tex]

-3 times the square root of 5

=============================================

Explanation:

Let [tex]x = \sqrt{5}[/tex]

Replace all the root 5 terms with x and we go from

[tex]3\sqrt{5}-8\sqrt{5}+2\sqrt{5}[/tex]

to

[tex]3x-8x+2x[/tex]

From here, combine like terms to get

[tex]3x-8x+2x = -5x+2x = -3x[/tex]

and the last thing to do is replace the x with sqrt(5)

[tex]-3x = -3\sqrt{5}[/tex]

Meaning that,

[tex]3x-8x+2x = -3x[/tex]

[tex]3\sqrt{5}-8\sqrt{5}+2\sqrt{5} = -3\sqrt{5}[/tex]

prove the following​

Answers

Answer:

Step-by-step explanation:

sin(180°-∅)=sin∅ as its in the 2nd quadrant

then tan(180°-∅)= -tan∅ as its in the 2nd quadrant and there only sin and cosec is positive and at last cos(180°-∅) = -cos∅ for the same reason

so by putting the values:

sin∅/sin∅ + -tan∅/tan∅ + -cos∅/cos∅ =1-1-1= -1

thanks ..

The graph of y=√x is translated 5 units to the left and 7 units up. What is the equation of the graph that results from this translation?

Answers

Answer: sqrt(x+5)+7.

If you have a function y=f(x-h)+k, where f is a base function, h is a horizontal translation, and k is a vertical translation:

To shift 5 units to the left and 7 units up, h must be -5, and k must be 7. So the equation is f(x+7)+k=sqrt(x+5) + 7.

Answer:

y = [tex]\sqrt{x+5}[/tex] + 7

Step-by-step explanation:

Given the graph of f(x) then f(x + k) is a horizontal translation of f(x)

• If k > 0 then a shift to the left of k units

• If k < 0 then a shift to the right of k units

Thus a translation of 5 units to the left

y = [tex]\sqrt{x+5}[/tex]

Given the graph of f(x) then f(x) + c is a vertical translation of f(x)

• If c > 0 then shift up by c units

• If c < 0 then shift down by c units

Thus

y = [tex]\sqrt{x+5}[/tex] + 7 ← translated equation

A finite geometric series is the sum of a sequence of numbers. Take the sequence 1, 2, 4, 8, … , for example. Notice that each number is twice the value of the previous number. So, a number in the sequence can be represented by the function f(n) = 2n–1. One way to write the sum of the sequence through the 5th number in the sequence is ∑5n-12n-1. This equation can also be written as S5 = 20 + 21 + 22 + 23 + 24. If we multiply this equation by 2, the equation becomes 2(S5) = 21 + 22 + 23 + 24 + 25. What happens if you subtract the two equations and solve for S5? Can you use this information to come up with a way to find any geometric series Sn in the form ∑an-1bn-1?

Answers

hope this helps you alot

Find the distance across the lake. Assume the triangles are similar.
85 m
X
у
20 m
60 m

Answers

Answer:

B. 255 m

Step-by-step explanation:

use similar triangle

L / 60 = 85 / 20

L = (85 * 60) / 20

L = 255 m

The distance across the lake will be 255 meters. Then the correct option is B.

What is the triangle?

A triangle is a three-sided polygon with three angles. The angles of the triangle add up to 180 degrees.

If the two triangles are similar, the ratio of the corresponding sides will be constant.

In an isosceles triangle, two angles and their opposite sides are equal.

The dimensions of the first triangle are L, 85, and y. And the dimensions of the second triangle are 60, 20, and x.

It is given that the triangles are similar.

Then the ratio of their corresponding sides will be

L / 60 = 85 / 20 = x / y

From first two terms, then the equation will be

L / 60 = 85 / 20

L / 60 = 4.25

       L = 4.25 x 60

       L = 255 m

The distance across the lake will be 255 meters.

Then the correct option is B.

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ5

The sum of two numbers is negative thirty. One number is five times the other

Answers

Answer:

-25, -5

Step-by-step explanation:

Let's write a system of equations. Lets call x and y the numbers, where x is 5 times y.

x + y = -30

x = 5y

Plugging this in, we get:

5y + y = -30

y = -5

Since y = -5, we can plug this in, and see that x = -25.

Answer:

-5 & -25

Step-by-step explanation:

1st number=x

2nd number=5x

x+5x=-30

6x=-30

x=-5

5x=-25

So the numbers are -5 & -25

A room in the shape of a cube has a floor area of 20.25 square metre what is its height ? what is its volume ? ​

Answers

Answer:

Height= 4.5 Volume= 91.125

Step-by-step explanation:

Height. Is the square root of the floor area = 4.5 volume is this length cubed = 91.125

{3, 6, 9, 12, 15, 18, 21, ...)

Answers

Answer:

Below

Step-by-step explanation:

5)

The sequence includes the terms 3,6,9,12,15.. and so on

Notice that each time we add 3.

The first term is 3.

We can see it in a different way

● 3 = 3×1

● 6 = 3×2

● 9 = 3×3

● 12 = 3×4

Let 1 be n. Notice what happens

● 3 = 3n

● 6 = 3 × (n+1)

● 9 = 3 × (n+2)

● 12 = 3 × (n+3)

So we can express it as.

● a1 = 3 × 1 =3

● a2 = 3×2 =6

● a3 = 3×3 = 9

So the third term is a3 wich is 9

● a6 = 3×6 = 18

So the sixth term is 18 .

■■■■■■■■■■■■■■■■■■■■■■■■■■

6)

the sequence is defined by:

● f(n-1) = -0.5 f(n)

Repalce n-1 with n and n with n+1

● f(n) = -0.5 f(n+1)

So to get a term you must multiply the next one by -0.5

The first term in the sequence is 120.

● 120 = -0.5 f(n+1)

● f(n+1) = 120/-0.5

● f(n+1) = -60

So the second term is -60

25 POINTS! FIRST TO ANSWER ****CORRECTLY**** GETS BRAINLIEST!

What number should be placed in the box to help complete the division calculation?
Numerical Answers Expected!

Answers

Answer:

The answer to your question is given below.

Step-by-step explanation:

To divide 2635 by 17 using long division method, we simply do the following:

2635 ÷ 17

17 can not go into 2. Therefore, we try 17 into 26, keeping 35 constant.

26 ÷ 17 = 1

Put the 1 on top.

Multiply 17 by 1

17 x 1 = 17

Subtract 17 from 26

26 – 17 = 9

Put the 9 in from of 35 to become 935

Next:

935 ÷ 17

17 can not go into 9. Therefore, we try 17 inot 93 keeping 5 constant.

93 ÷ 17 = 5

Put the 5 on top together with the 1 to become 15.

Multiply 17 by 5

17 x 5 = 85

Subtract 85 from 93

93 – 85 = 8

Put the 8 in front of 5 to become 85

Next:

85 ÷ 17

17 can not go into 8. Therefore, we try 85

85 ÷ 17 = 5

Put the 5 on top together with 15 to become 155

Multiply 17 by 5

17 x 5 = 85

Subtract 85 from 85

85 – 85 = 0

Since no number is remaining, we shall stop here.

Therefore,

2635 ÷ 17 = 155

Please attached photo for further details.

I need help It’s honors 7 math pls help

Answers

Answer:

411,600.000× 10^3 OR 4.11600000×10^8

Step-by-step explanation:

The expontent seems to be 3 so you move the decimal point over <this way 3

if it is 8 you move it over this way < 8

Answer:

411,600.000× 10^3 OR 4.11600000×10^8

Step-by-step explanation:

The expontent seems to be 3 so you move the decimal point over <this way 3

if it is 8 you move it over this way < 8

The row-echelon form of the augmented matrix of a system of equations is given. Find the solution of the system. FYI it’s not b

Answers

Answer:

c.

Step-by-step explanation:

From the last row in the matrix z = 1.

From the second row:

y + 5z = -4

y = -4 -5(1) = -9.

From the first row:

x + -1 = -3

x = - 3 + 1

x = -2.

Please helpppp anyone fast

Answers

Answer:

2, 3, 4

Step-by-step explanation:

Since the question is asking which of the following are functions, lets define what it is first

Function: An equation for one answer for y for every x

This means that every x coordinate can have a y, but multiple x coordinates can have the same y coordinate

Because of this it has to be every one of them except the first one

Dell's coffee shop sells cappuccinos, mochas, and lattes. The table gives the number of servings of each beverage sold in a day.

Answers

Answer:

[tex]C. \left[\begin{array}{c}370\\228.5\\332\end{array}\right][/tex]

Step-by-step explanation:

Given the table of values for number of servings:

[tex]\begin{center}\begin{tabular}{ c c c c} & Small & Medium & Large\\ Cappuccino & 70 & 55 & 62 \\ Mocha & 42 & 34 & 39 \\ Latte & 59 & 63 & 47 \\ \end{tabular}\end{center}[/tex]

Cost of each coffee for a particular serving is same.

Cost of small serving = $1.50

Cost of medium serving = $2

Cost of large serving = $2.50

To find:

Matrix of revenue generated from sales of each coffee.

Solution:

Revenue generated by a particular coffee = Sum of (cost of each serving multiplied by number of particular servings)

So, revenue by Cappuccino = [tex]70 \times 1.5 +55 \times 2 + 62 \times 2.5 = \bold{\$370}[/tex]

So, revenue by Mocha = [tex]42\times 1.5 +34 \times 2 + 39 \times 2.5 = \bold{\$228.5}[/tex]

So, revenue by Latte = [tex]59\times 1.5 +63\times 2 + 47 \times 2.5 = \bold{\$332}[/tex]

So, the correct answer is:

[tex]C. \left[\begin{array}{c}370\\228.5\\332\end{array}\right][/tex]

waht is the gcf of 4x^5 + 7x^3

Answers

Answer:

Step-by-step explanation:

4x^5 + 7x^3

x^3(4x^2 + 7)

The GCF is x^3

To get from home to work, Felix can either take a bike path through the rectangular park or ride his bike along two sides of the park. How much farther would Felix travel by riding along two sides of the park than he would by taking the path through the park?

Answers

Answer:

c=5.9/6(G)

Step-by-step explanation:

first find the 2 distances.

a^2+b^2=c^2                    c=2.4+.7              

7^2+2.4^2=c^2                  c=3.1

.49+5.85=c^2                    

c^2=6.34

c=√6.34

c=2.51.

next subtract the two distances to find the difference.

c=2.51-3.1

c=.59

so the distance would be .59 which can be rounded up to .60/G

explanation on how I knew the answer.

Im reviewing for the math 8th grade staar.

need help will give you a good rating

Answers

Explanation : As you can see, [tex]\sqrt{-16}[/tex] is not a real number, and hence should be expressed as 4[tex]i[/tex], [tex]i[/tex] being an imaginary number. Respectively [tex]\sqrt{-64}[/tex] will be 8[tex]i[/tex]. Therefore this expression boils down to [tex]\left(3+4i\right)\left(6-8i\right)[/tex]. All we have to do from now on is expand this expression.

Apply the rule [tex]\left(a+bi\right)\left(c+di\right)=\left(ac-bd\right)+\left(ad+bc\right)i[/tex], in this case where [tex]a=3,\:b=4,\:c=6,\:d=-8[/tex],

[tex]\left(3\cdot \:6-4\left(-8\right)\right)+\left(3\left(-8\right)+4\cdot \:6\right)i[/tex]

Let's simplify each part, [tex]3\cdot \:6-4\left(-8\right)[/tex] and [tex]3\left(-8\right)+4\cdot \:6[/tex]. Afterwards we can add [tex]i[/tex], and refine.

[tex]3\cdot \:6-4\left(-8\right) = 50[/tex] ; [tex]3\left(-8\right)+4\cdot \:6 = 0[/tex]

Therefore our simplified expression will be [tex]50+0i[/tex], otherwise known as just 50. That is our solution.

Answer:

Step-by-step explanation:

is the sum of any two numbers is greater than the larger of the two numbers?

Answers

Answer: Yes the sum of any two numbers is greater than the larger of the two numbers.

Step-by-step explanation:

Yes the sum of any two numbers is greater than the larger of the two numbers.

Let us assume that the two numbers are a and b and ab is the number.

a + b > a

b > a – a

b > 0

This therefore implies that b > 0.

This may however not be true when the value of b is zero(0) or a negative number.

Please answer this question now

Answers

Answer:

48°

Step-by-step explanation:

arc BC = 136(2) -145 = 127

arc DC = 83(2) - 127 = 39

arc AD = 360 - 145- 127 - 39 = 48

Answer:

49 degrees

Step-by-step explanation:

Measure of arc ABC = 116*2 = 232 degrees.

Measure of arc BC = 232-145 = 87 degrees.

Measure of arc BCD = 83*2 = 166 degrees.

Measure of arc DC = 166-87 = 79 degrees.

Measure of arc AD = 360 - (145+87+79) = 360 - 311 = 49 degrees

You are making a scaledrawing of a room using a scale of1 inch : 4 feet.a. The room is 14 feet by 18 feet. Find itsdimensions in the drawing.b. A sofa in the room has a length of 6 feet.Find the length of the sofa in thedrawing.c. You want to enlarge the scale drawing.How would you change the scale todouble the dimensions of the drawing?Explain.

Answers

Answer:

a. 3.5 inches by 4.5 inches

b. 1.5 inches

c. Divide 48 inches by 2 and multiply 1 inch by 12 to get a scale of 1 : 2

Step-by-step explanation:

A scale is a representative fraction showing the relationship between length on a drawing and actual length.

i.e scale = [tex]\frac{length on a drawing}{actual length}[/tex]

 scale = 1 inch : 4 feet

a. The dimensions in the drawing can be determined as;

1 inch : 4 feet implies an inch on the drawing equates 4 feet on actual length.

[tex]\frac{14}{4}[/tex] = 3.5 inches

[tex]\frac{18}{4}[/tex] = 4.5 inches

Dimensions on drawing is 3.5 inches by 4.5 inches.

b. The length of the sofa is 6 feet, its length on the drawing is;

[tex]\frac{6}{4}[/tex] = 1.5 inches

c. To enlarge the scale so as to double the dimensions of the drawing, we have;

12 inches = 1 feet

4 feet = 4 × 12 = 48 inches

given scale = 1 inch : 48 inches

Thus, divide 48 inches by 2 and multiply 1 inch by 12.

scale = 12 inch : 24 inch

scale = 1 : 2

To double the dimensions of the drawing, the scale required is 1 : 2. This implies that a unit measure on the drawing is synonymous to 2 measures on the actual reading.

Which equation does the graph of the systems of equations solve? 2 linear graphs. They intersect at 1,4

Answers

Answer:

See below.

Step-by-step explanation:

There is an infinite n umber of systems of equations that has (1, 4) as its solution. Are you given choices? Try x = 1 and y = 4 in each equation of the choices. The set of two equations that are true when those values of x and y are used is the answer.

Can you please Solve for x

Answers

x - 3 = 27

add three to both sides

then x= 30

●✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎❀✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎●

         Hi my lil bunny!

❧⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯☙

Let's solve your equation step-by-step.

[tex]x-3=27[/tex]

Step 1: Add 3 to both sides.

[tex]x -3 + 3 = 27 +3[/tex]

[tex]x = 30[/tex]

So the answer is : [tex]x = 30[/tex]

❧⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯☙

●✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎❀✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎●

Hope this helped you.

Could you maybe give brainliest..?

❀*May*❀

Porfavor resolv erme esas preguntas o una :v porfis .El salón de mi clase de matemáticas mide 700 m2, cuánto mide 1/4 del salón? Cuánto mide 3/4 del salón? . Cuántos minutos son 3/5 de media hora? . Se necesitan 4/7 de litro de pintura para pintar un metro cuadrado de pared, si queremos pintar 2/5 de metro cuadrado de pared, cuánta pintura necesitaremos? . Si se necesitan 2/5 de naranja para hacer un vaso de jugo de naranja, cuántas naranjas necesitas para hacer 2 vasos y medio?

Answers

Answer:

Explained below.

Step-by-step explanation:

The question is:

Please answer me these questions or one: v please. My math class room is 700 m2, how much is 1/4 of the room? How long is 3/4 of the room? . How many minutes is 3/5 of a half hour? . It takes 4/7 of a liter of paint to paint a square meter of wall, if we want to paint 2/5 of a square meter of wall, how much paint will we need? . If it takes 2/5 of an orange to make a glass of orange juice, how many oranges do you need to make 2 and a half glasses?

(1)

Compute 1/4th of the math class room as follows:

[tex]=700\times\frac{1}{4}\\=175[/tex]

Thus, 1/4th of the math class room is 175 m².

(2)

Compute 3/4th of the math class room as follows:

[tex]=700\times\frac{3}{4}\\=525[/tex]

Thus, 3/4th of the math class room is 525 m².

(3)

Compute 3/5th of half an hour as follows:

[tex]=30\times \frac{3}[5}\\=18[/tex]

Thus, 3/5th of half an hour is 18 minutes.

(4)

A square meter of wall required 4/7 liter of paint.

Then 2/5 of a square meter will require,

[tex]=\frac{4}{7}\times \frac{2}{5}\\\\=\frac{8}{35}[/tex]

Thus, 8/35 liter of paint will be used to pain /5 of a square meter of the wall.

(5)

1 glass of orange juice can be made using 2/5 of an orange.

Then 2 and half glass will require,

[tex]=\frac{2}{5}\times 2\frac{1}{2}\\\\=\frac{2}{5}\times \frac{5}{2}\\\\=1[/tex]

Thus, 1 orange will be required to make 2 and half glass of orange juice.

Find the value of x.
ASAP!!

Answers

Answer:

x = 80

Step-by-step explanation:

Tangent Chord Angle  =1/2 Intercepted Arc

40 = 1/2 x

80 = x

Please help! Urgent! Will mark Brainliest!

Answers

Answer:

[tex]x = 15[/tex]

Step-by-step explanation:

Since lines f and g are parallel, that means that the top angles will be the same, while the bottom angles will also be the same.

The angles of any quadrilaterals all add up to 360°, so we can create the equation like this:

[tex]3x + 3x + (6x + 45) + (6x+45) = 360[/tex]

Combine like terms so we can get a simpler equation:

[tex]6x + 12x + 90 = 360\\18x + 90 = 360[/tex]

Now let's solve for x!

[tex]18x + 90 - 90 = 360 - 90\\18x = 270\\18x\div18 = 270\div18\\x = 15[/tex]

So [tex]x = 15[/tex].

Hope this helped!

Answer:

15

Step-by-step explanation:

3x + 6x + 45 = 180

9x = 135

x = 15

what is 3/8 as a proportional ratio fraction

Answers

It can be 12/32, 6/16, and a lot others. just multiply the same numbers for both the numerator and denominator.

A weather balloon holds 2,600 cubic meters of helium. The density of helium is 0.1755 kilograms per cubic meter. How many kilograms of helium does the balloon contain?

Answers

Answer:

The balloon contains 456.3 kg of helium

Step-by-step explanation:

Density=mass / volume

Volume=2600 cubic meters of helium

Density=0.1755 kilograms per cubic meters

Mass=x

Find mass, x

Density=mass / volume

Mass=Density × volume

=0.1755 * 2600

=456.3 kg

The balloon contains 456.3 kg of helium

Find the height of the triangle by applying formulas for the area of a triangle and your knowledge about
triangles.
9 in
9 in.
Xin
6 in

Answers

Answer:

8.5

Step-by-step explanation:

Applying pythagora's theorem,

hypotenuse^2 = opposite^2 + adjacent^2

but, hypotenuse = 9

opposite = X

adjacent = 1/2(base of triangle)= 1/2(6)

adjacent = 3

9^2 = X^2 + 3^2

X^2 = 81 - 9

X^2 = 72

X = 8.5

mm
a
Solve this system of equations using substitution:
y = 2x-4
x + 2y = 10
Step 1: Substitute for hin the second equation. Which is
the resulting equation?
2x - 4 = 10
x + 2x - 4 = 10
x + 2(2x - 4) = 10

Answers

Answer:

x + 2(2x-4) = 10

Step-by-step explanation:

Here in this question, we want to select which is the correct answer if we substitute for the value of y in the second equation, using the first.

In the first, we have;

y = 2x -4

Now, let’s input this value of y into the second equation.

By direct substitution, what we have is the following;

x + 2y = 10

—-> x + 2(2x -4) = 10

Other Questions
jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ? show that the point p(-6,2), Q(1,7) and R(6,3) are the vertices of scalene triangle The work function of a certain metal is = 3.55 eV. Determine the minimum frequency of light f0 for which photoelectrons are emitted from the metal. (Planck's constant is: h = 4.135710-15 eVs.) These box plots show daily low temperatures for a sample of days in two different towns. Yo tengo once aos y no tengo hermanos. Mitiene cuarenta aos. l es grande y cmico.padremadrehermanohija Divide a 6 and 3/4 inch line into three parts so that each part is 1/4 inch shorter than the one before it. How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )plz correct answerbe quick either you will eat or you will be picked up what happens to the chromosomes if nondisjunction occurs during meiosis one versus meiosis two Find a linear inequality with the following solution set. Each grid line represents one unit.Pllzzzzzzz help!!!!!!!!!! Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A.control their nucleotide length B.regulate their copy number C.control their target-site choice D.avoid transposing into their own genome Andrews Corp. ended the year carrying $153,576,000 worth of inventory. Had they sold their entire inventory at their current prices, how much more revenue would it have brought to Andrews Corp.?